Students -Welcome back! -Get test folders from table -Grades due tomorrow at lunch -Missing items -Unit 5 test -Lab notebooks -Today – Review Mid-term – Curve set later today -Avg: 27 (out of 36) 75% -Range: Still working on grades -Syllabus coming on Monday….diverge from Mercer’s group -Phones in bins…off or muted…please and thank you

AthElites 2015 National Champions!!

StudentsEnd times -Get 2 handouts -Syllabus4 th 12:45 -Biotech pre-test7 th 2:40 8 th 3:10 -Get test folders & lab notebooks -2 nd quarter grades posted -New seats today…say good bye & then hello -Needed – volunteers for tomorrow night’s Open House -After moving, phones in bin…muted or off…please & thank you 1 st 2 nd 4 th 7 th 8 th Semester avg

Chapter 20 Essential Question LO 3.5 The student can justify the claim that humans can manipulate heritable information by identifying at least two commonly used technologies.

Bacterium Bacterial chromosome Plasmid Cell containing gene of interest Gene inserted into plasmid Recombinant DNA (plasmid) Plasmid put into bacterial cell Gene of interest DNA of chromosome Recombinate bacterium Host cell grown in culture, to form a clone of cells containing the “cloned” gene of interest Protein harvested Basic research on protein Basic research and various applications Gene of interest Copies of gene Basic research on gene Gene for pest resistance inserted into plants Gene used to alter bacteria for cleaning up toxic waste Protein dissolves blood clots in heart attack therapy Human growth hormone treats stunted growth Protein expressed by gene of interest Figure 20.2 Overview of gene cloning

Chapter 20: DNA Technology and Genomics 1.How is a gene cut out of a chromosome? -Restriction enzymes -Recognize a palindrome sequence -Originally found in bacteria -Overhangs are “sticky ends” & will bind to any complementary sequence -DNA ligase makes a recombinant DNA molecule Restriction site DNA G A A T T C C T T A A G Restriction enzyme cuts the sugar-phosphate backbones at each arrow DNA fragment from another source is added. Base pairing of sticky ends produces various combinations. DNA ligase seals the strands. Sticky end Fragment from different DNA molecule cut by the same restriction enzyme One possible combination Recombinant DNA molecule G C T T A A A A T T C G C T T A A G G G G A A T TCA A T T C C T T A A G C T T A A G 1 2 3

Students -Open House volunteers -6 – 8 -20’ increments -Books for a library in Ghana…in lieu of cans -New or gently used -Pre-school – 6 th grade -Atkins Key Club -Phones in bin…off or muted…please & thank you

Mr. Bennett, I know it has been a while, but this is Hope Kelly and I took your AP biology class my junior year of high school at the Career Center. I currently am a sophomore at NC State and have decided to major in human biology with a plan to apply to a graduate program for physical therapy upon graduation. I have been meaning to reach out to you for a while to tell you how appreciative I am to have taken your course during high school. I can not express to you how prepared I have been for my biology classes here at State due to your AP Biology course and I just wanted to let you know what a great teacher and mentor you were to me! I am currently taking a genetics course this semester and I still remember concepts that you taught in your class that continue to help me in my studies. I remember your class being one of the hardest of my high school career, but I now appreciate the vigor and passion you incorporate into your course material and teaching practices. I hope that all is well and that you are having a great start to your semester!

Chapter 20: DNA Technology and Genomics 1.How is a gene cut out of a chromosome? 2.How is recombinant DNA cloned? Recombinant DNA plasmids Sticky ends Human DNA Fragments Human cell Gene of interest Bacterial cell amp R gene (ampicillin resistance) Bacterial plasmid Restriction site lacZ gene (lactose breakdown) 1 Isolate plasmid DNA and human DNA. 2 Cut both DNA samples with the same restriction enzyme, one that makes a single cut within the lacZ gene and many cuts within the human DNA. 3 Mix the DNAs; they join by base pairing. The products are recombinant plasmids and many nonrecombinant plasmids.

Chapter 20: DNA Technology and Genomics 1.How is a gene cut out of a chromosome? 2.How is recombinant DNA cloned? Recombinant bacteria Recombinant DNA plasmids Sticky ends Human DNA Fragments Human cell Gene of interest Bacterial cell amp R gene (ampicillin resistance) Bacterial plasmid Restriction site lacZ gene (lactose breakdown) 1 Isolate plasmid DNA and human DNA. 2 Cut both DNA samples with the same restriction enzyme, one that makes a single cut within the lacZ gene and many cuts within the human DNA. 3 Mix the DNAs; they join by base pairing. The products are recombinant plasmids and many nonrecombinant plasmids. 4 Introduce the DNA into bacterial cells that have a mutation in their own lacZ gene.

Chapter 20: DNA Technology and Genomics 1.How is a gene cut out of a chromosome? 2.How is recombinant DNA cloned? Colony carrying non- recombinant plasmid with intact lacZ gene Bacterial clone Colony carrying re- combinant plasmid with disrupted lacZ gene Recombinant bacteria Recombinant DNA plasmids Sticky ends Human DNA Fragments Human cell Gene of interest Bacterial cell amp R gene (ampicillin resistance) Bacterial plasmid Restriction site lacZ gene (lactose breakdown) 1 Isolate plasmid DNA and human DNA. 2 Cut both DNA samples with the same restriction enzyme, one that makes a single cut within the lacZ gene and many cuts within the human DNA. 3 Mix the DNAs; they join by base pairing. The products are recombinant plasmids and many nonrecombinant plasmids. 4 Introduce the DNA into bacterial cells that have a mutation in their own lacZ gene. 5 Plate the bacteria on agar containing ampicillin and X-gal. Incubate until colonies grow.

Chapter 20: DNA Technology and Genomics 1.How is a gene cut out of a chromosome? 2.How is recombinant DNA cloned? 3.How are genomes of interest kept in a research lab? -Genomic libraries -Collection of clones in either plasmids or phages Foreign genome cut up with restriction enzyme Recombinant plasmids Recombinant phage DNA Phage clones (b) Phage library (a) Plasmid library or Bacterial clones

Chapter 20: DNA Technology and Genomics 1.How is a gene cut out of a chromosome? 2.How is recombinant DNA cloned? 3.How are genomes of interest kept in a research lab? 4.How can we find a “gene of interest” in a genomic library? -Screen a genomic library using a radioactive probe -Nucleic acid probe hybridization

Figure 20.5 Nucleic acid probe hybridization

Chapter 20: DNA Technology and Genomics 1.How is a gene cut out of a chromosome? 2.How is recombinant DNA cloned? 3.How are genomes of interest kept in a research lab? 4.How can we find a “gene of interest” in a genomic library? 5.What is cDNA & how is it made? -complementary DNA -complementary to mRNA -Only exons present -Isolate mRNA -Use reverse transcriptase to make cDNA -cDNA libraries made from different tissues, stages of development, in response drugs, etc

Students -Thank you for those who came out last night. -Phone in bin…muted or off…please & thank you!

Chapter 20: DNA Technology and Genomics 1.How is a gene cut out of a chromosome? 2.How is recombinant DNA cloned? 3.How are genomes of interest kept in a research lab? 4.How can we find a “gene of interest” in a genomic library? 5.What is cDNA & how is it made? 6.What is PCR & how is it used? -Polymerase chain reaction -Used to amplify DNA -Forensics -Paternity testing

Figure 20.7 The polymerase chain reaction (PCR) 1.Denature DNA – 95°C 2.Annealing – 65°C 3.Extension – 72°C Repeat this cycle 25 – 35 times Each cycle doubles the DNA Making DNA - Template - Primers - dNTPs - DNA polymerase (Taq – heat resistant)

Chapter 20: DNA Technology and Genomics 1.How is a gene cut out of a chromosome? 2.How is recombinant DNA cloned? 3.How are genomes of interest kept in a research lab? 4.How can we find a “gene of interest” in a genomic library? 5.What is cDNA & how is it made? 6.What is PCR & how is it used? 7.What is gel electrophoresis? -Method to separate DNA, RNA or protein based on size & charge -Forest analogy….

Figure 20.8 Gel Electrophoresis 1.DNA loaded into wells 2.Electrical current applied 3.(-) DNA moves toward (+) 4.Shorter molecules move faster 5.DNA is visualized

Chapter 20: DNA Technology and Genomics 1.How is a gene cut out of a chromosome? 2.How is recombinant DNA cloned? 3.How are genomes of interest kept in a research lab? 4.How can we find a “gene of interest” in a genomic library? 5.What is cDNA & how is it made? 6.What is PCR & how is it used? 7.What is gel electrophoresis? 8.What is RFLP analysis? -Restriction Fragment Length Polymorphism -Illustrates each person has a unique DNA fingerprint (1 st forensic test) -Combines restriction digestion & gel electrophoresis

Normal  -globin allele Sickle-cell mutant  -globin allele 175 bp 201 bpLarge fragment DdeI Ddel 376 bp Large fragment DdeI restriction sites in normal and sickle-cell alleles of  -globin gene. Electrophoresis of restriction fragments from normal and sickle-cell alleles. Normal allele Sickle-cell allele Large fragment 201 bp 175 bp 376 bp (a) (b) Figure 20.9 Using restriction fragment analysis to distinguish the normal and sickle-cell alleles of the  -globin gene DdeI Recognition Site

Chapter 20: DNA Technology and Genomics DNA Forensics now -Uses PCR to amplify DNA at 13 different loci -Short Tandem Repeats (STRs) are amplified -…CCCTCATTCATTCATTCATTCATCGC… -CODIS – Combined DNA Index Service – federal DNA database -Using 13 loci increases discrimination & reduces Random Match Probability -RMP = ~1 in 2.7 trillion for each of us

Chapter 20: DNA Technology and Genomics 1.How is a gene cut out of a chromosome? 2.How is recombinant DNA cloned? 3.How are genomes of interest kept in a research lab? 4.How can we find a “gene of interest” in a genomic library? 5.What is cDNA & how is it made? 6.What is PCR & how is it used? 7.What is gel electrophoresis? 8.What is RFLP analysis? 9.What is Southern blot analysis? -Combination of RFLP & nucleic acid probe hybridization -Transfers DNA from gel to a solid substrate (nitrocellulose paper)

Figure Southern blotting of DNA fragments

Students -Get possible FRQs -Techniques covered -Restriction enzymes- cDNA -Making recombinant DNA - PCR -Cloning & transformation- RFLPs (early & current forensics) -Screening a library- Southern blotting (northern & western) -Learning logs….11 questions….start NOW!!!! -Phones in bin….off or muted…please & thank you

Chapter 20: DNA Technology and Genomics 1.How is a gene cut out of a chromosome? 2.How is recombinant DNA cloned? 3.How are genomes of interest kept in a research lab? 4.How can we find a “gene of interest” in a genomic library? 5.What is cDNA & how is it made? 6.What is PCR & how is it used? 7.What is gel electrophoresis? 8.What is RFLP analysis? 9.What is Southern blot analysis? 10. What is a northern blot & a western blot -northern – detects RNA with nucleic acid probe -western – detects protein with an antibody 11. How is DNA sequenced? -Dideoxy termination method -3’ –OH is missing; therefore, no extension & termination occurs -Combines copying DNA, electrophoresis, & fluorescent labeling

Figure Dideoxy chain-termination method for sequencing DNA What ever color is detected is the last nucleotide. No extension off of dideoxy nucleotide Reagents needed to make DNA + dideoxy nucleotides (10:1) (10 : 1)

Chapter 20: DNA Technology and Genomics 1.How is a gene cut out of a chromosome? 2.How is recombinant DNA cloned? 3.How are genomes of interest kept in a research lab? 4.How can we find a “gene of interest” in a genomic library? 5.What is cDNA & how is it made? 6.What is PCR & how is it used? 7.What is gel electrophoresis? 8.What is RFLP analysis? 9.What is Southern blot analysis? 10. What is a northern blot & a western blot 11. How is DNA sequenced? 12. What are genomics? -The study of whole sets of genes and their interactions -Human Genome Project has provided sequence – now we must determine how genes interact -Proteomics – study of protein interactions 13. How can gene function be determined? -in vitro mutagenesis – disable gene & observe consequences -RNA interference (RNAi) – silencing of gene expression by making DS- RNA with matching sequence which triggers breakdown of mRNA.

Chapter 20: DNA Technology and Genomics 1.How is a gene cut out of a chromosome? 2.How is recombinant DNA cloned? 3.How are genomes of interest kept in a research lab? 4.How can we find a “gene of interest” in a genomic library? 5.What is cDNA & how is it made? 6.What is PCR & how is it used? 7.What is gel electrophoresis? 8.What is RFLP analysis? 9.What is Southern blot analysis? 10. What is a northern blot & a western blot 11. How is DNA sequenced? 12. What are genomics? 13. How can gene function be determined? -in vitro mutagenesis – disable gene & observe consequences -RNA interference (RNAi) – silencing of gene expression by using DS- RNA with matching sequence which triggers breakdown of mRNA. 14.What is a DNA microarray? -Method used to measure expression of thousands of genes at once -Uses cDNA to bind to gene segments on a glass slide

Figure Research Method DNA microarray assay of gene expression levels

Chapter 20: DNA Technology and Genomics 1.How is a gene cut out of a chromosome? 2.How is recombinant DNA cloned? 3.How are genomes of interest kept in a research lab? 4.How can we find a “gene of interest” in a genomic library? 5.What is cDNA & how is it made? 6.What is PCR & how is it used? 7.What is gel electrophoresis? 8.What is RFLP analysis? 9.What is Southern blot analysis? 10. What is a northern blot & a western blot 11. How is DNA sequenced? 12. What are genomics? 13. How can gene function be determined?. 14. What is a DNA microarray? 15. What are some practical applications of DNA technology? -Disease diagnosis -HIV diagnosis using RT-PCR -PCR of “questionable” alleles followed by DNA sequencing -Viral gene therapy -Uses a virus to deliver a normal allele to “replace” a mutant allele -Crossing over will “swap out” the alleles

Figure Gene therapy using a retroviral vector 1.Insert “good” RNA into retrovirus 2. Infect bone marrow cells, which are stem cells 3. Viral DNA inserts into chromosome 4.Inject “fixed” cells into patient Fixing stem cells SHOULD have lasting effects since they can replicate themselves & differentiate/mature.

Chapter 20: DNA Technology and Genomics 15. What are some practical applications of DNA technology? -Disease diagnosis -Viral gene therapy -Production of pharmaceutical products -Using expression vectors to make proteins -Insulin, growth hormone, TPA -Receptor mimic to block HIV infection -Vaccine production -Forensics -Environmental Clean-up & Bioremediation -Transgenic animals -Transgenic plants -Ti plasmid

Figure Using Ti plasmid to produce transgenic plants