Overview  Introduction  Biological network data  Text mining  Gene Ontology  Expression data basics  Expression, text mining, and GO  Modules and.

Slides:

Advertisements

Similar presentations

Look for other standards: - BioPAX (composition) - CellML (aggregation) - Other SBML L3 extensions (modules - rule-based modeling)

Advertisements

Network biology Wang Jie Shanghai Institutes of Biological Sciences.

Putting genetic interactions in context through a global modular decomposition Jamal.

University at BuffaloThe State University of New York Young-Rae Cho Department of Computer Science and Engineering State University of New York at Buffalo.

Bio 465 Summary. Overview Conserved DNA Conserved DNA Drug Targets, TreeSAAP Drug Targets, TreeSAAP Next Generation Sequencing Next Generation Sequencing.

Connecting Function and Topology (of small biological circuits) International Workshop and Conference on Network Science, Queens, NY, May 22, 2007 Chao.

1 Protein-Protein Interaction Networks MSC Seminar in Computational Biology

Sai Moturu. Introduction Current approaches to microarray data analysis –Analysis of experimental data followed by a posterior process where biological.

Data Mining Presentation Learning Patterns in the Dynamics of Biological Networks Chang hun You, Lawrence B. Holder, Diane J. Cook.

Introduction to molecular networks Sushmita Roy BMI/CS 576 Nov 6 th, 2014.

Programmed cells: Interfacing natural and engineered gene networks Kobayashi, Kærn, Araki, Chung, Gardner, Cantor & Collins,( PNAS 2004). You, Cox, Weiss.

1 and 3 November, 2006 Chapter 17 Regulation in Eukaryotes.

VL Netzwerke, WS 2007/08 Edda Klipp 1 Max Planck Institute Molecular Genetics Humboldt University Berlin Theoretical Biophysics Networks in Metabolism.

DEMO CSE fall. What is GeneMANIA GeneMANIA finds other genes that are related to a set of input genes, using a very large set of functional.

Modeling Functional Genomics Datasets CVM Lessons 4&5 10 July 2007Bindu Nanduri.

Systematic Analysis of Interactome: A New Trend in Bioinformatics KOCSEA Technical Symposium 2010 Young-Rae Cho, Ph.D. Assistant Professor Department of.

Protus 2.0: Ontology-based semantic recommendation in programming tutoring system Presentor: Boban Vesin Boban Vesin, Aleksandra Klašnja-Milićević Higher.

Malignant Melanoma and CDKN2A

9/30/2004TCSS588A Isabelle Bichindaritz1 Introduction to Bioinformatics.

Overview  Introduction  Biological network data  Text mining  Gene Ontology  Expression data basics  Expression, text mining, and GO  Modules and.

Biology 1060 Chapter 17 From Gene to Protein. Genetic Information Important: Fig Describe how genes control phenotype –E.g., explain dwarfism in.

Community Detection by Modularity Optimization Jooyoung Lee

Synthetic biology: New engineering rules for emerging discipline Andrianantoandro E; Basu S; Karig D K; Weiss R. Molecular Systems Biology 2006.

March 24, Integrating genomic knowledge sources through an anatomy ontology Gennari JH, Silberfein A, and Wiley JC Pac Symp Biocomputing 2005:

Paper prepared for presentation at the 16 th ICABR Conference – 128 th EAAE Seminar “The Political Economy of the Bioeconomy: Biotechnology and Biofuel”

Initiating translation

Genetics: Chapter 7. What is genetics? The science of heredity; includes the study of genes, how they carry information, how they are replicated, how.

From Gene to RNA Kanokporn Boonsirichai Molecular Biology of the Cell Bruce Alberts, Alexander Johnson, Julian Lewis, Martin Raff, Keith Roberts,

Biology Chapter 12 Section 5 Gene Regulation. Objectives ______________a typical gene _________how lac genes are turned off and on __________how most.

Supplemental figure 1: Correlation coefficients between signal intensities from biological replicates of wild.

Overview  Introduction  Biological network data  Text mining  Gene Ontology  Expression data basics  Expression, text mining, and GO  Modules and.

Gene Ontology TM (GO) Consortium Jennifer I Clark EMBL Outstation - European Bioinformatics Institute (EBI), Hinxton, Cambridge CB10 1SD, UK Objectives:

The ‘regulates’ relationships Chris, David, Tanya.

A Biology Primer Part IV: Gene networks and systems biology Vasileios Hatzivassiloglou University of Texas at Dallas.

Control of Gene Expression

Section 2 CHAPTER 10. PROTEIN SYNTHESIS IN PROKARYOTES Both prokaryotic and eukaryotic cells are able to regulate which genes are expressed and which.

A Quantitative Overview to Gene Expression Profiling in Animal Genetics Antonio (Toni) Reverter Bioinformatics Group CSIRO Livestock Industries Queensland.

CSCD 218 : DATA COMMUNICATIONS AND NETWORKING 1 LECTURE 5 INTRODUCTION AND BASIC CONCEPTS TUTORIALS SECTION ONE / QUIZ ONE LECTURER : FERDINAND KATSRIKU.

Functional Annotation and Functional Enrichment. Annotation Structural Annotation – defining the boundaries of features of interest (coding regions, regulatory.

AP Biology Discussion Notes Friday 02/06/2015. Goals for Today Be able to describe RNA processing and why it is EVOLUTIONARILY important. In a more specific.

Overview  Introduction  Biological network data  Text mining  Gene Ontology  Expression data basics  Expression, text mining, and GO  Modules and.

Differential analysis of Eigengene Networks: Finding And Analyzing Shared Modules Across Multiple Microarray Datasets Peter Langfelder and Steve Horvath.

Databases, Ontologies and Text mining Session Introduction Part 2 Carole Goble, University of Manchester, UK Dietrich Rebholz-Schuhmann, EBI, UK Philip.

Opportunities for Text Mining in Bioinformatics (CS591-CXZ Text Data Mining Seminar) Dec. 8, 2004 ChengXiang Zhai Department of Computer Science University.

1 GCCTCAATGGATCCACCACCCTTTTTGGGCA GCCTCAATGGATCCACCACCCTTTTTGGTGCA AGCCTCAATGGATCCACCACCCTTTTTGGTGC AAGCCTCAATGGATCCACCACCCTTTTTGGTG CAAGCCTCAATGGATCCACCACCCTTTTTGGT.

CSC, Dec.15-16,2005. Cytoscape Team Trey Ideker Mark Anderson Nerius Landys Ryan Kelley Chris Workman Past contributors: Nada Amin Owen Ozier Jonathan.

Discovering functional interaction patterns in Protein-Protein Interactions Networks   Authors: Mehmet E Turnalp Tolga Can Presented By: Sandeep Kumar.

Title Authors Introduction Text, text, text, text, text, text Background Information Text, text, text, text, text, text Observations Text, text, text,

Biological Networks. Can a biologist fix a radio? Lazebnik, Cancer Cell, 2002.

By:miguel iturrade.  A computer network is a group of computers that are connected to each other for the purpose of communication.

Knowledge Support for Modeling and Simulation Michal Ševčenko Czech Technical University in Prague.

Protein Synthesis - The “Stuff of Life”. 2 Proteins Proteins are the “workhorse” molecule found in organisms. The blue print for proteins is coded in.

Agenda 3/8 Transcription Notes Epigenetics Activity Turn in: Nothing Homework: Transcription video and notes, Chp 14 reading/notes, RNA reading/questions.

Chapter 7: The Blueprint of Life, from DNA to Protein.

Control of Gene Expression

Materials & Methods Introduction Abstract Results Conclusion

Overview Expression data basics Introduction Biological network data

Overview Gene Ontology Introduction Biological network data

Introduction to Gene Expression

9 Future Challenges for Bioinformatics

Materials & Methods Introduction Abstract Results Conclusion

Overview Domains and conclusion Introduction Biological network data

Materials & Methods Introduction Abstract Results Conclusion

Differential expression levels of archaella operon genes and respiratory chain genes in Δsaci_pp2a and Δsaci_ptp. Differential expression levels of archaella.

Regulatory Circuits Controlling Photosynthesis Gene Expression

Title Introduction: Discussion & Conclusion: Methods & Results:

Functional classification and visualization of differentially expressed genes. Functional classification and visualization of differentially expressed.

Materials & Methods Introduction Abstract Results Conclusion

Materials & Methods Introduction Abstract Results Conclusion

Title Firstname Lastname 1, Firstname Lastname 2 and Firstname Lastname 3 1 Affiliations. Dummy text, dummy text, dummy text 2 Affiliations. Dummy text,

Presentation transcript:

Overview  Introduction  Biological network data  Text mining  Gene Ontology  Expression data basics  Expression, text mining, and GO  Modules and complexes  Domains and conclusion

In this section  Network topology primer  Finding complexes using topology data  Finding complexes using coexpression  Finding “active modules”

Modules  A self-contained component of a system  With well-defined interfaces to other components

Network modules

Why study modularity in networks? To reduce complexity

Example 1: operons Source:

Example 2: co-expression Source:

Example 3: Signal transduction pathways Source:

Example 4: Transcription Source:

Example 5: Topological modules (a.k.a. complexes) Source:

Complex A structure consisting of several weakly- connected macromolecules  Ribosome  Spliceosome  Transcription factor complex

Characteristics of complexes Source: Science Feb 4;307(5710)

In this session Source: