Mutations The ultimate source of new alleles. Changes to the DNA Sequence Entire set of DNA is copied each time a cell divides. Copying process may not.

Slides:

Advertisements

Similar presentations

Cause and effect of mutation

Advertisements

KEY CONCEPT Mutations are changes in DNA that may or may not affect observable traits/characteristics.

SC.912.L.16.4 Explain how mutations in the DNA sequence may or may not result in phenotypic change. Explain how mutations in gametes may result in.

Genetic Change DOT Point Distinguish between mutations of chromosomes distinguisg.

Mutations. General Definition Long Notes: Any change in DNA sequence is called a mutation. Abbreviated Notes (AN): Mutation (mut) = DNA sequence (seq)

Section 1: Mutation and Genetic Change

Defined: a change in an organism’s DNA Where: DNA or Chromosomes When: During replication, Synapses, or Crossing-Over Mutations can affect a single.

A mutation is a change in an organism’s DNA.

Changes in DNA can produce variation

Mutations are changes in DNA that may or may not affect phenotype.

8.7 – Mutations. Key Concept  Mutations are changes in DNA that may or may not affect phenotype. mutated base.

MUTATIONS SC STANDARD B-4.9: The student will exemplify ways in which new characteristics are introduced into an organism or a population.

Mutations 13.3.

Genetic Mutations Increasing Genetic Diversity May 4, 2010.

Ch Mutations Section Objectives:

Genetic Mutations. Mutations Mistakes made in the DNA sequencing They can have a range of effects. They can affect the genetic information that is passed.

DNA Mutations What is a mutation? 1) Change in the DNA of a gene. 2) When a cell puts its genetic code into action it is making precisely the proteins.

Mutations. A Mutation is a change in an organism’s DNA  It can occur naturally whenever a base is incorrectly copied, especially during DNA Replication.

Mutations Any change in DNA sequence which is not immediately and properly repaired. If they occur in somatic cells then they are non-inheritable, if in.

1 NOTES: MUTATIONS 2 MUTATIONS: MUTATIONS = changes in the DNA sequence that affect genetic information.

Introduction A mutation is a change in the normal DNA sequence. They are usually neutral, having no effect on the fitness of the organism. Sometimes,

NOTES – CH 17, part 2 DNA & MUTATIONS

Genetic Disorders Genetic Mutations Because DNA controls characteristics of a cell it must be copied before a cell reproduces Sometimes mistakes occur.

MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.

8.7 Mutations A mutation is a change in an organism’s DNA. This may or may not affect phenotype.

Ch Mutations Section Objectives: Categorize the different kinds of mutations that can occur in DNA. Compare the effects of different kinds of mutations.

MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.

Genes in ActionSection 1 Section 1: Mutation and Genetic Change Preview Bellringer Key Ideas Mutation: The Basis of Genetic Change Several Kinds of Mutations.

Mutations Mutations are changes in DNA Mutations are changes in DNA These can occur in: These can occur in: Somatic cells – can cause tumours/cancersSomatic.

13.3 Mutations. POINT > Define a gene in simple terms POINT > Define and describe genetic mutations POINT > Distinguish between gene and chromosomal mutations.

Mutations. Recall: DNA is made up of a sequence of nucleotides. A nucleotide is composed of a deoxyribose sugar, a phosphate group and a nitrogenous base.

Genetic Mutation. Mutation Greatest source of genetic diversity A change in the sequence of nucleotides of a gene. Some changes to the DNA will alter.

MUTATIONS Mutations Defined: a change in an organism’s DNA. Many kinds of mutations can occur, especially during replication. 2 Types: 1)Gene Mutations:

8.7 Mutations A mutation is a change in an organism’s DNA. May occur during replication. May affect a single gene, or an entire chromosome May or may not.

12.4 Mutations.  What is a mutation and where can it occur? Inheritable change in genetic code 99.9 % are harmful, only 0.1% are helpful  Any change.

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.

Cause and effect of mutation

Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.

Section 11.3: Genetic Changes

Section 1: Mutation and Genetic Change

Mutations 6/26/2018 SB2d.

Mutations and genetic variation

Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

A mutation is a change in an organism’s DNA.

Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations -changes in a single base pair in DNA=changes in the nucleotide.

11.3 Section Objectives – page 296

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

Some mutations affect a single gene, while others affect an entire chromosome.

Section 1: Mutation and Genetic Change

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

Copyright Pearson Prentice Hall

A mutation is a change in an organism’s DNA.

Section 20.4 Mutations and Genetic Variation

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA

Presentation transcript:

Mutations The ultimate source of new alleles

Changes to the DNA Sequence Entire set of DNA is copied each time a cell divides. Copying process may not be error free. Chance that a base or series of bases is either copied incorrectly, deleted, reversed or inserted as an addition. Low normal error rate – about one mistake per billion base pairs copied.

Think about this error rate! Approx. 3 billion base pairs in human genome (meaning, 3 billion base pairs in each somatic cell) Keeping this error rate in mind, how many errors should you expect each time one of your cells divides? (10 16 cell divisions in a lifetime!!!) How many mutations should you expect in a lifetime? In a day?

Mutation as source of genetic variation A large percentage of DNA codes for nothing! Mutations in these sections do not lead to variation. Generally, mutations are kept in check by the DNA repair system. Mutated cells are often either fixed or destroyed! Mutations in somatic cells are not carried forward to the next generations. Only mutations in sex cells can be passed down from parent to offspring and further on.

Harmful mutations Most mutations in genes (parts of DNA that code for proteins) are harmful. Usually stop or alter production of a protein. This causes the protein to malfunction. E.g. albinism, thalassemia,

Silent mutations Cause no changes in amino acid sequence or final protein product. This may be because: - mutation occurs outside gene region - codon change was for the same amino acid - minor change in amino acid sequence may not have altered the shape or active site of the protein.

Beneficial Mutations Sometimes mutations improve the survival chances of organism. Most common example is of flu virus – frequent mutations leading to changes in its glycoprotein “coat” (outer covering) helps it avoid detection by the host’s immune system. MRSA – hospital super bug! Mutations passed down through gametes, if beneficial, continue to persist in a population.

Mutagens – agents that speed up the normal rate of mutation Radiation – nuclear, UV, X-rays Diet, Alcohol, Tobacco smoke – diets high in saturated fat, MSG, high alcohol intake, tobacco tar – irritants that induce cancer causing mutations Chemicals – asbestos, alcohol-based solvents like paint thinners and formaldehyde, and many many others… Microorganisms – HIV, HPV, Hepatitis B virus, aflatoxin produced by a fungus commonly growing on peanuts.