The Molecular Theorem Proving with Hairpin Loop Structure MEC Seminar 2002. 8. 9 Park, Ji-Yoon.

Slides:



Advertisements
Similar presentations
Introduction to Sizing DNA on an Agarose Gel HC 70AL Spring 2009 April 2, 2009 By Kristin Gill.
Advertisements

1% Agarose Gel DNA Electrophoresis Running time : 52 minutes Distance measured from the well to the top of the second band: 4,5 cm Running voltage: 100.
Gel electrophoresis Separating molecules by size and charge.
Polyacrylamide gel electrophoresis (PAGE) Electrophoresis in a polyacrylamide matrix separating or resolving molecules in a mixture under the influence.
Lab.8 8RBs0Ghg_48
Gel Electrophoresis and Probes (Southern Blotting) Group A,
Chapter 12 The Hitachi FMBIO II Fluorescence Imaging System ©2002 Academic Press.
Identifying an Unknown Plasmid Avity Norman Cal Poly San Luis Obispo.
The 3 rd Research on Theorem Proving MEC Meeting Hanyang University Proteome Research Lab Park, Ji-Yoon.
5‘- AGAGTTTGATCCTGGCTCAG - 3’ 1492R 5'- GGTTACCTTGTTACGACTT - 3’ 785F
Presented by Pardeep Dhillon and Ehsan Fadaei
Page Gel Electrophoresis gel electrophoresis – moving DNA through a gel medium using an electric current Why can we move DNA with electricity?
Polyacrylamide Gel Electrophoresis. Electrophoresis Horizontal Agarose Gels Agarose forms a gel or molecular sieve that supports the movement of small.
Self-Assembling DNA Graphs Summarized by Park, Ji - Yoon.
The 3 rd Research on Theorem Proving MEC Meeting Hanyang University Proteome Research Lab Hanyang University Proteome Research Lab Park, Ji-Yoon.
A 2 nd year college student working in the lab for the summer forgot to label the Tube of plasmid DNA that he/she was given. So being the brilliant graduate.
Gel Electrophoresis gel electrophoresis – moving DNA through a gel medium using an electric current Why can we move DNA with electricity? DNA has a negative.
Cascading Whiplash PCR with a Nicking Enzyme MEC Seminar Park, Ji-Yoon Daisuke Matsuda and Masayuki Yamamura.
Copyright © 2007 American Medical Association. All rights reserved.
Gel Electrophoresis.
PCR troubleshooting.
Lab.8
In 1st image I got desired band at 3 cycle (high efficieny, 30 sec on and 45 sec off) but in next image I got at 4 cycle (high efficieny, 30 sec on and.
A. Doménech-Sánchez, C. Juan, J.L. Pérez, C.I. Berrocal 
Wet (DNA) computing 2001년 9월 20일 이지연
Evaluation of TNF-alpha gene (G308A) and MBL2 gene codon 54 polymorphisms in Turkish patients with tuberculosis  Esma Ceylan, Mutlu Karkucak, Hikmet Coban,
DNA Implementation of Theorem Proving
© 2013 Elsevier, Inc. All rights reserved.
A. Doménech-Sánchez, C. Juan, J.L. Pérez, C.I. Berrocal 
Small RNA Sample Preparation
© 2013 Elsevier, Inc. All rights reserved.
Activity of quinupristin–dalfopristin in invasive isolates of Streptococcus pneumoniae from Italy  A. Pantosti, F. D'Ambrosio, E. Bordi, A. Scotto d'Abusco,
DNA-based Theorem Proving - Present Work
Jonathan A. Schumacher, Stephen D. Jenson, Kojo S. J
Separation techniques
Technology that uses electricity to separate molecules in a gel slab
Betaine, Dimethyl Sulfoxide, and 7-Deaza-dGTP, a Powerful Mixture for Amplification of GC-Rich DNA Sequences  Marco Musso, Renata Bocciardi, Sara Parodi,
Yanggu Shi, Sharon F. Terry, Patrick F. Terry, Lionel G
Electrophoresis / SDS-PAGE
Prevalence of diarrheagenic Escherichia coli strains detected by PCR in patients with travelers' diarrhea  M. Vargas, J. Gascón, F. Gallardo, M. T. Jimenez.
A PCR-based method to differentiate between Acinetobacter baumannii and Acinetobacter genomic species 13TU  P.G. Higgins, H. Wisplinghoff, O. Krut, H.
Fecal multiple molecular tests to detect colorectal cancer in stool
Analysis of human DNA present in the digestive tract of Aedes aegypti mosquitoes for possible forensic application  B.R.C. Vieira, E.F. Carvalho, D.A.
Rhodococcus equi pneumonia in a heart transplant recipient in Korea, with emphasis on microbial diagnosis  S.J. Yoo, H. Sung, J.D. Chae, M. -N. Kim, C.H.
Improved performance with saliva and urine as alternative DNA sources for malaria diagnosis by mitochondrial DNA-based PCR assays  C. Putaporntip, P.
A new multiplex PCR for easy screening of methicillin-resistant Staphylococcus aureus SCCmec types I–V  K. Boye, M.D. Bartels, I.S. Andersen, J.A. Møller,
Cohort study of the seasonal effect on nasal carriage and the presence of Mycobacterium leprae in an endemic area in the general population  M. Lavania,
Prevalence of antibiotic resistance and virulence factors encoding genes in clinical Staphylococcus aureus isolates in Saudi Arabia  Hussein H. Abulreesh,
Differentiation of Cryptococcus neoformans varieties and Cryptococcus gattii using CAP59-based loop-mediated isothermal DNA amplification  S. Lucas, M.
Validation of an apicoplast genome target for the detection of Plasmodium species using polymerase chain reaction and loop mediated isothermal amplification 
Single nucleotide polymorphism-based molecular typing of M
Self-Assembling DNA Graphs
Polynucleotide Ligase Activity of Eukaryotic Topoisomerase I
Volume 119, Issue 4, Pages (October 2000)
Separating molecules by size and charge
L. Hasap, P. Thanakiatkrai, A. Linacre, T. Kitpipit 
Hanyang University Proteome Research Lab
RSC Unravels the Nucleosome
Micropipettes.
Volume 88, Issue 4, Pages (April 2005)
Agarose gel electrophoresis of DNA extracted from EDTA and formic acid decalcified bone marrow trephine biopsies. Agarose gel electrophoresis of DNA extracted.
Sitong Sheng, Daniel M. Czajkowsky, Zhifeng Shao  Biophysical Journal 
Genomic DNA Sample Preparation
Identification of differential gene expression in germinal vesicle vs
Giorgio Sirugo, Kenneth K. Kidd  The American Journal of Human Genetics 
Follicle-stimulating hormone receptor gene mutations are rare in Japanese women with premature ovarian failure and polycystic ovary syndrome  Kenji Takakura,
Association of a polymorphism in the ornithine decarboxylase gene with male androgenetic alopecia  Rachel A. Garton, MD, Amy J. McMichael, MD, Joel Sugarman,
Agarose gel electrophoresis illustrating randomly amplified polymorphic DNA (RAPD) fingerprints of the four reference strains and 12 tick isolates produced.
Supplementary Fig. 1 bp E F G H I Hybrid 1 SP2/0 MW P3X (-)
MHC, major histocompatibility complex; L, ladder.
Presentation transcript:

The Molecular Theorem Proving with Hairpin Loop Structure MEC Seminar Park, Ji-Yoon

~P~Q Q P

Amplification Fig 1. The amplification results in 3% agarose gel electrophoresis 50 bp 25 bp 23 bp

Indirect Confirmation M Fig 2. The indirect confirmation the solution in 3% agarose gel electrophoresis Lane 1: ~P, ~Q, Q Lane 2; ~P, P, Q Lane 3; P, Q, ~Q Lane 4; P, ~P, ~Q Lane 5; P, ~Q Lane 6; P, Q Lane 7; P, ~P Lane 8; Q, ~P Lane 9; Q, ~Q Lane 10; ~P, ~Q Lane 11; ~P, Q Lane 12; Ligation mixture Lane M; 25 bp DNA ladder 25 bp 50 bp

Denaturing PAGE Fig 3. Denaturing polyacrylamide gel electrophoresis of ligation mixture bp 50 bp Smear band

Atomic Force Microscopy(AFM) Ligation mixture 의 AFM Imaging 수행중 … * 두께 : 10 nm * 길이 : 200 nm Ligation mixture 의 AFM Imaging 수행중 … * 두께 : 10 nm * 길이 : 200 nm