Detecting Protein Function and Protein-Protein Interactions from Genome Sequences TuyetLinh Nguyen.

Slides:

Advertisements

Similar presentations

Structure and Function of 30nm Fibers Deduced From the Linear Distribution of Genetic Information. Part One: The Logical Framework Christine M. Povinelli,

Advertisements

Development of on-line database & tool for protein interface analysis Suk-hoon Jung.

Integration of chemical-genetic and genetic interaction data links bioactive compounds to cellular target pathways Parsons et al Nature Biotechnology.

Zhen Shi June 2, 2010 Journal Club. Introduction Most disease-causing mutations are thought to confer radical changes to proteins (Wang and Moult, 2001;

PPI network construction and false positive detection Jin Chen CSE Fall 1.

Annotating a Scarlet Runner Bean genome fragment put together by shotgun sequencing Scarlet Runner ean Max Bachour.

Protein Structure Database Introduction Database of Comparative Protein Structure Models ModBase 生資所 g 詹濠先.

Ontology annotation: mapping genomic regions biological function Paul D Thomas, Huaiyu Mi and Suzanna Lewis.

MainLabMeeting_PingZheng_ Ran the fgenesh on the large contigs from the matina_1_6_RNA dataset and performed BLAST the Putative genes against.

Predicting domain-domain interactions using a parsimony approach Katia Guimaraes, Ph.D. NCBI / NLM / NIH.

Research Methodology of Biotechnology: Protein-Protein Interactions Yao-Te Huang Aug 16, 2011.

A comprehensive analysis of protein-protein interactions in Saccharomyces cerevisiae Article by Peter Uetz, et.al. Presented by Kerstin Obando.

Sequence Similarity Searching Class 4 March 2010.

Optimatization of a New Score Function for the Detection of Remote Homologs Kann et al.

Protein-protein interactions

Bioinformatics: a Multidisciplinary Challenge Ron Y. Pinter Dept. of Computer Science Technion March 12, 2003.

Protein domains vs. structure domains - an example.

Domain Assignment to Transcription Factors 416 Proteins with at least one SCOP DBD assignment 416 Proteins with at least one SCOP DBD assignment PFAM assignments.

BACKGROUND E. coli is a free living, gram negative bacterium which colonizes the lower gut of animals. Since it is a model organism, a lot of experimental.

Dali: A Protein Structural Comparison Algorithm Using 2D Distance Matrices.

Marcotte EM, Pellegrini M, Ng HL, Rice DW, Yeates TO, Eisenberg D. (1999). Detecting protein function and protein-protein interactions from genome sequences.

Affinity chromatography/mass spec Bait protein GST Page 252.

Systematic Analysis of Interactome: A New Trend in Bioinformatics KOCSEA Technical Symposium 2010 Young-Rae Cho, Ph.D. Assistant Professor Department of.

Functional Linkages between Proteins. Introduction Piles of Information Flakes of Knowledge AGCATCCGACTAGCATCAGCTAGCAGCAGA CTCACGATGTGACTGCATGCGTCATTATCTA.

Modelling, comparison, and analysis of proteomes Ram Samudrala University of Washington.

Functional Associations of Protein in Entire Genomes Sequences Bioinformatics Center of Shanghai Institutes for Biological Sciences Bingding.

Improving Gene Function Prediction Using Gene Neighborhoods Kwangmin Choi Bioinformatics Program School of Informatics Indiana University, Bloomington,

Finish up array applications Move on to proteomics Protein microarrays.

COURSE OF BIOINFORMATICS Exam_31/01/2014 A.

Does The Evidence Support Evolution? “More than a century ago, Darwin and Huxley posited that humans share recent common ancestors with the African great.

Discovering the Correlation Between Evolutionary Genomics and Protein-Protein Interaction Rezaul Kabir and Brett Thompson

Modelling Genome Structure and Function Ram Samudrala University of Washington.

Protein Secondary Structure, Bioinformatics Tools, and Multiple Sequence Alignments Finding Similar Sequences Predicting Secondary Structures Predicting.

Functional Genomics Functional genomic datasets Biological networks Integrating genomic datasets BIO520 BioinformaticsJim Lund.

An Integrated Computational Framework for Systems Biology Ram Samudrala University of Washington How does the genome of an organism specify its behaviour.

Biological Signal Detection for Protein Function Prediction Investigators: Yang Dai Prime Grant Support: NSF Problem Statement and Motivation Technical.

Anis Karimpour-Fard ‡, Ryan T. Gill †,

Overview  Introduction  Biological network data  Text mining  Gene Ontology  Expression data basics  Expression, text mining, and GO  Modules and.

Introduction to Bioinformatics Dr. Rybarczyk, PhD University of North Carolina-Chapel Hill

The complete genome sequence of Mycobacterium avium subspecies paratuberculosis Comparative Microbial Genomics Mette Herold, s Bent Petersen,

Genomics II: The Proteome Using high-throughput methods to identify proteins and to understand their function.

The Mammalian Protein – Protein Interaction Database and Its Viewing System That Is Linked to the Main FANTOM2 Viewer Genome Research (2003) Speaker: 蔡欣吟.

Eukaryotic Gene Prediction Rui Alves. How are eukaryotic genes different? DNA RNA Pol mRNA Ryb Protein.

EB3233 Bioinformatics Introduction to Bioinformatics.

Reverse Interactomics

An overview of Bioinformatics. Cell and Central Dogma.

I. Prolinks: a database of protein functional linkage derived from coevolution II. STRING: known and predicted protein-protein associations, integrated.

Functional and Evolutionary Attributes through Analysis of Metabolism Sophia Tsoka European Bioinformatics Institute Cambridge UK.

Jobs, Careers, Internships, Senior Projects and Research Computer Application Development K-12 education Industrial Training Bioinformatics Validation.

Bioinformatics and Computational Biology

3DM: Protein engineering Super-family platforms Bio-Prodict DM super-family systems Henk-Jan Joosten Remko Kuipers Tom v/d Bergh Bas Vroling.

1 Protein-Protein Interactions High-throughput strategy –Prediction from sequence In silico analysis –Protein A from species A: domain 1 and 2 –Protein.

1 Computational functional genomics Lital Haham Sivan Pearl.

Modelling proteomes Ram Samudrala University of Washington.

PROTEIN INTERACTION NETWORK – INFERENCE TOOL DIVYA RAO CANDIDATE FOR MASTER OF SCIENCE IN BIOINFORMATICS ADVISOR: Dr. FILIPPO MENCZER CAPSTONE PROJECT.

BNFO 615 Fall 2016 Usman Roshan NJIT. Outline Machine learning for bioinformatics – Basic machine learning algorithms – Applications to bioinformatics.

FLiPS Functional Linkage Prediction Service.

Does The Evidence Support Evolution?

Pfam: multiple sequence alignments and HMM-profiles of protein domains

Prediction of Regulatory Elements for Non-Model Organisms Rachita Sharma, Patricia.

Genome organization and Bioinformatics

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

A User’s Guide to GO: Structural and Functional Annotation

University of Washington

Protein domains Jasmin sutkovic

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Computational Genomics of Noncoding RNA Genes

TF candidate selection pipeline.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Presentation transcript:

Detecting Protein Function and Protein-Protein Interactions from Genome Sequences TuyetLinh Nguyen

Outline Putative Protein Interactions Domain Fusion Analysis Hypothesis for Evolution of Protein Interactions False predictions

Putative Protein Interactions 4290 protein sequences 6809 pairs of nonhomologous sequences Five candidates

Domain Fusion Analysis First method uses the annotation of proteins given in the SWISS-PROT database Second test of the interactions predicted by the domain fusion analysis uses as confirmation the Database of Interacting Proteins Third test of domain fusion predictions is by another computational method for predicting interactions.

Hypothesis for Evolution of Protein Interactions

False Predictions Physical interactions may be made by the domain fusion analysis The domain cannot distinguish between homologs that bind and those that do not

Conclusion Genomics information opens new paths to biochemical discoveries.