Mutations Csaba Bödör, Semmelweis University, 1 st Dept. of Pathology.

Slides:

Advertisements

Similar presentations

Cancer & Mutations Powerpoint

Advertisements

DNA molecule Gene 1 Gene 2 Gene 3 DNA template strand TRANSCRIPTION TRANSLATION mRNA Protein Codon Amino acid 1.

Chapter 17.5 Gene expression and Mutations

How is the amino acid sequence determined?

Mutations are changes in genetic material

Mutations Mutation- a change in the DNA nucleotide sequence

5. Point mutations can affect protein structure and function

DNA, Mutations and Hazardous Waste. Prokaryote Cell.

Mutations are changes in the genetic material of a cell or virus

Topic 4.1 Chromosomes, Genes, Alleles and Mutations.

Definition : Any change in the nucleotide sequence of DNA.

Ch Mutations Section Objectives:

DNA Mutations What is a mutation? 1) Change in the DNA of a gene. 2) When a cell puts its genetic code into action it is making precisely the proteins.

Chapter 14 Homework is due on Sunday, January 25 at 11:59 pm The Chapter 13 and 14 test is on Monday.

13-3 Mutations Can be good, bad or nothing!!. What is a mutation? The word is Latin for “to change”. There are 2 types: – 1) Single gene changes – 2)

Using a Codon Chart & Mutations Today’s Goal: Review codons and anticodons and describe several types of mutations. Quiz tomorrow over ch 12 and 13 material.

Point Mutations Silent Missense Nonsense Frameshift.

the Genetic Code Shown as mRNA 5′ → 3′ 64 codons Redundant

MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.

 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.

Wake-up 1.Explain the difference between transcription and translation. (Hint: Think about what is made) 2.Explain difference between codon and anticodon.

MUTATIONS. Mutations  errors/changes in the DNA sequence that are inherited.  May have a negative effect, a positive effect, or no effect.

Mistakes in the code. Review: What does DNA look like? How is DNA made? How does DNA instruct the cell to make proteins? What determines the order of.

Mutation: The Source of Genetic Variation Chapter 11.

Rate of mutations in the Human Genome A study published in Current Biology in 2009, shows that in total, we all carry new mutations in our DNA.

1 & 2) Transcription vs. Translation  DNA  mRNA; nucleus  Making a protein; cytoplasm 3) How many tRNA nucleotides form an anticodon? 33.

Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)

DNA Mutations. Remember that during DNA replication, the DNA makes an exact copy of itself before it divides. DNA replication is not always accurate.

Chapter 10 Mutations Student Mutations can change the meaning of genes  A mutation is any change in the nucleotide sequence of DNA.  Mutations.

Mistakes in the code. Review: What does DNA look like? How is DNA for a new cell made? How does DNA instruct the cell to make proteins? What determines.

Mutation. What you need to know How alteration of chromosome number or structurally altered chromosomes can cause genetic disorders How point mutations.

A change in the nucleotide sequence of DNA Ultimate source of genetic diversity Gene vs. Chromosome.

Genetic code and mutations

LO: SWBAT explain how protein shape is determined and differentiate between the different types of mutations. DN: h/0 protein synthesis HW: Read pp.

Molecular mechanism of mutation

Gene Mutations.

Protein on Normal Red Blood Cells

GENE MUTATIONS aka point mutations © 2016 Paul Billiet ODWS.

GENETIC MUTATIONS Section 5.6 Pg. 259.

Types of Mutations.

Daily Warm-Up Dec. 17th What is a genetic mutation? Homework:

Mutations and Genetic Disorders

DNA and mutations SC.912.L.16.4.

Biology Mutations SNL Biology Copyright Pearson Prentice Hall.

Methods used to study mutations

Types of point mutations

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations -changes in a single base pair in DNA=changes in the nucleotide.

Entry Task Apply: Suppose a template strand of DNA had the following sequence: DNA: T A C G G A T A A C T A C C G G G T A T T C A A What would.

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations Alternative alleles (traits) of many genes result from changes.

Mutations are changes in the genetic material of a cell or virus

DNA and Mutations.

Distinguish between codon and anticodon.

DNA and Mutations.

Mutations Ms MacCormack Fall 2018.

Mutation: Some Definitions

Mutation Notes.

13.3 Mutations.

C-Notes: Mutations Stnd: BI.4.c 10/23/13

Mutations Notes.

Section 20.4 Mutations and Genetic Variation

Mutations: Changes in Genes

Presentation transcript:

Mutations Csaba Bödör, Semmelweis University, 1 st Dept. of Pathology

Introduction chromosome mutations (involve larger segments) & DNA mutations (changes in the sequence) DNA mutations (changes in the sequence) Two distinct types of mutations: Two distinct types of mutations:

Introduction Key terms: Mutation - Mutagen - Change in the genetic code (DNA sequence) Agents responsible for the generation of mutations Carcinogen - Agents causing cancer

* Mutagenic effect Mutated DNA molecule Mutagens  Environmental agents: Spontaneous  Spontaneous : Chemical mutagens, nuclear radiation, UV-radiation (sunlight) Mistakes occurring during the DNA replication, „hot-spots”

* Mutagenic effect Repaired DNA molecule      ** ** ** Mutated DNA molecule

The flow of the genetic information Transcription DNA Translation *mRNA protein DNA mRNA mutated protein Normal function Altered function, no function, disease …

Different types – different outcomes 1, Single base substitutions (point mutations) 2, Frameshift mutations:

Different types – different outcomes 1, Single base substitutions (point mutations) Nonsense mutations Convert an amino-acid specifying codon to a STOP (termination codon, TAA,TAG,TGA) … … CAC CAG GCA … Normal sequence Mutant sequence … … His Gln Ala … … … CAC TAG GCA … … … His STOP. position: 498 Normal protein: 1480 amino acids Mutant protein: 498 amino acids Short protein > no function!

Different types – different outcomes 1, Single base substitutions (point mutations) Missense mutations Result in replacement of one amino-acid by another Example (sickle-cell disease): … ACT CCT GAG GAG … … Thr Pro Glu Glu … Normal  -chain of hemoglobin (HbA) Mutant  -chain of hemoglobin (HbS) … ACT CCT GTG GAG … … Thr Pro Val Glu … NORMAL RED BLOOD CELLS SICKLE RED BLOOD CELLS

This single mutation (A>T) is responsible for the development of sickle cell anemia

Different types – different outcomes 1, Single base substitutions (point mutations) Silent mutations Result in no change in the protein product TCT > Serine TCA > Serine TCG > Serine TCC > Serine Mutation: Result in a substitution of a closely related amino acid or

Different types – different outcomes 1, Single base substitutions (point mutations) 2, Frameshift mutations:

Different types – different outcomes 2, Frameshift mutations: Result from the insertion or deletion of one or two nucleotidesand causes an alteration of the reading frame nucleotides and causes an alteration of the reading frame Example: Original reading frame New reading frame Only 1 base insertion > completely diff. amino acid sequence ! met ala leu trp ile arg phe ile arg ATGGCCCTGTGGATCCGCTTCATTAGG… met ser pro val asp pro leu his stop GCCCTGTGGATCCGCTTCATTAGG… ATG A

Summary - DNA mutations Mutations: Mutations: changes in the nucleotide sequence of the DNA Cause: Cause: mutagens > environmental (chemicals, radiations,…) spontaneous mut. (errors during the DNA repl.) Types: Types: base substitutions > (missense, nonsense, silent) frameshift mutations (insertions, deletions) Consequences: Consequences: altered function, destroyed function, altered phenotype, disease… … provide the variation necessary for evolution (see evolution)