1 Applied Developmental Biology Dr. Lubna Tahtamouni The Hashemite University 2010 Week # 2 Tools in Developmental Biology 1

2 Questions to be answered in Dev. Bio.: - axis determination (AP, DV, LR) *Q. how do you ‘break’ the symmetry of the egg? Sperm entry, localized determinants - cell differentiation, cell proliferation, cell growth - cell migration, polarization (symmetric vs asymmetric cell division), cell shape (giving cells different morphologies, e.g. neurons), cell death - morphogenesis (how cells come together to form tissues; and how these tissues migrate) - organogenesis - timing (biological clock) 2

3 Questions to be answered in Dev. Bio.: -aging - germ cell development, fertilization - stem cells (what are they (multipotency, ability to self- renew), why did they become so ‘trendy’ (Dolly the sheep, 1997, showed that cloning was possible; development of human ES cells, 1998) - regeneration - How efficient is human development? (talk about implantation ) 3

4 Developmental biology Model systems Worm (C. elegans) Fly (Drosophila melanogaster) Fish (zebrafish, medaka) Mouse Xenopus (laevis, tropicalis) Chick (Quail) Sea urchin (echinoderm) Many systems available: which one to use: most powerful one where you can study your questions of interest. (also, many of these model systems are used to study processes other than developmental biology). 4

5 MODEL SYSTEMS for the experimental analysis of development Drosophila melanogaster Mus musculis Gallus domesticus Caenorhabditis elegans Xenopus laevis and tropicalis Arbacia punculata 5

66 One of the answers to some of these questions: Differential Gene Expression - DNA is the same in all cells: genomic equivalence - Some genes are mutated, or silenced but not lost!!!!!!!

7 Central Dogma of Life Reverse Transcription 7

88 How to prove that some genes are expressed and some are not? -Test for TEMPORAL/SPATIAL expression of RNA Blotting In situ hybridization PCR - Test for the function of a certain gene Gain of function: microinjection Transfection Electroporation Transgenic animals Loss of function

9 Proteins RNA DNA CELLS TISSUE Histology Cell Biology Biochemistry Molecular Biology Northern Blotting Real-Time PCR -To study gene expression Northern Blotting Real-Time PCR -To study gene expression Western Blotting -To detect proteins ELISA -To quantify proteins Enzyme Assays -To measure enzyme activity Western Blotting -To detect proteins ELISA -To quantify proteins Enzyme Assays -To measure enzyme activity Southern Blotting -To find copy number of genes Genome Sequencing Southern Blotting -To find copy number of genes Genome Sequencing Staining to find -how the cells look (anatomy) Staining to find -how the cells look (anatomy) 9

10 Blotting Techniques Northern Blotting ( mRNA expression) Southern Blotting (copy number) Western Blotting ( protein expression) 10

11 Western Blotting 11

12 Western Blotting 12

13 E Enzyme I Immuno S Sorbent A Assay Test to find out something Protein molecule that performs a chemical reaction Attachment of antibodies L Linked Linking an enzyme to an assay/test Technique based on antigen-antibody reaction 13

14 Well in a microtiter plate Well with antibodies Antibody structure Well with antibodies and BSA added Well with antibodies, BSA, and test sample Well after washes with wash buffer Secondary antibody linked to an enzynme is added to the well Well after removing excess antibody Well after adding substrate Color developed due to the formation of a substrate 14

15 Southern / Northern Blotting 15

16 In situ hybridization

17 RT-PCR Real-Time PCR -To study gene expression RT-PCR Real-Time PCR -To study gene expression PCR 17

18 PCR : Polymerase Chain Reaction 18

19 4 copies 32 copies 16 copies 8 copies = millions of copies End of 35 cycles Reverse Transcriptase- Polymerase Chain Reaction Marker PCR products RT RNA 19

20 Preparation of cDNA or first strand RT 5’ GACCCAAUUGGUCAGCUAAAAAAA 3’ mRNA 5’ GACCCAAUUGGUCAGCUAAAAAAA 3’ 3’ CTGGGTTAACCAGTCGATTTTTTT 5’ 1 ST strand cDNA (complementary DNA) A, T, G, C dNTPs Reverse transcriptase ……TTTTTTT 5’ Reverse Transcription Reverse Transcription 20

21 Fate mapping 21

22 Gain-of-Function Transgenic animal Loss-of-Function RNAi 22

23 Gain-of-Function/Trangenics 23

24 Loss-of-Function/RNAi 24

25 Loss-of-Function/RNAi 25

26 THE END