© 2012 Pearson Education, Inc. Lecture by Edward J. Zalisko PowerPoint Lectures for Campbell Biology: Concepts & Connections, Seventh Edition Reece, Taylor, Simon, and Dickey Chapter 8 The Cellular Basis of Reproduction and Inheritance

REGULATION OF THE CELL CYCLE AND CANCER © 2012 Pearson Education, Inc.

 Cancer is the result of unregulated cell division!  Development of cancer is a multi-step process Cancer and Regulation of the Cell Cycle © 2012 Pearson Education, Inc.

 Cell division is controlled by –the presence of essential nutrients, –growth factors, proteins that stimulate division –Ex: VEGF, PDGF –Check-points along cell cycle –Signals that limit cell division –density-dependent inhibition, in which crowded cells stop dividing, and –anchorage dependence, the need for cells to be in contact with a solid surface to divide. Normal Cell Division is a Regulated Process © 2012 Pearson Education, Inc.

Figure 8.7A Cultured cells suspended in liquid The addition of growth factor

Figure 8.7B Anchorage Single layer of cells Removal of cells Restoration of single layer by cell division

 Divide when they aren’t supposed to  lose dependence on growth factors signals  ignore STOP signals and cell cycle checkpoints  Lose density-dependent inhibition Characteristics of Cancerous Cells © 2012 Pearson Education, Inc.

Checkpoints in the Cell Cycle: Quality Control Systems If a cell fails any checkpoint - default is arrest of cell cycle and/or cell death G O = cell not actively involved in division process

Figure 8.8B Receptor protein Signal transduction pathway Growth factor Relay proteins Plasma membrane E XTRACELLULAR F LUID C YTOPLASM G 1 checkpoint G1G1 S M G2G2 Control system

THE GENETIC BASIS OF CANCER © 2012 Pearson Education, Inc.

 Cancer is the result of unregulated cell division!  Development of cancer is a multi-step process  Requires the accumulation of multiple DNA mutations in genes that regulate normal cell pathways Cancer and Regulation of the Cell Cycle © 2012 Pearson Education, Inc. Chromosomes 1 mutation 2 mutations 3 mutations 4 mutations Normal cell Malignant cell

What is a mutation?  Change in DNA sequence of a cell  Germline mutation – A change in the DNA sequence that can be inherited from either parent  Somatic mutation –A change in the DNA sequence in cells other than sperm or egg –The mutation is present in the cancer cell and its offspring, but not in the patient’s healthy cells

Examples of mutations Sequence1Sequence 2Type ACTCGTTAGGCA Substitution ACTCGTTAGGCAACTCGGCA Deletion ACTCGTTAGGCA ACTCGTTATCAGGCA Insertion ACTCGTTAGGCA ACTTTGCAGGCA Inversion ACTCGTTAGGCA Duplication ACTCCTTAGGCA ACTCGTTAGTTAGGCA

11.16 Cancer results from mutations in genes that control cell division  Mutations in two types of genes can cause cancer. 1.Oncogenes –Proto-oncogenes are normal genes that promote cell division. –Mutations to proto-oncogenes create cancer-causing oncogenes that often stimulate cell division. –Ras 2.Tumor-suppressor genes –Tumor-suppressor genes normally inhibit cell division or function in the repair of DNA damage. –Mutations inactivate the genes and allow uncontrolled division to occur. –p53 © 2012 Pearson Education, Inc.

Ras - A proto-oncogene  Proto-oncogenes STIMULATE cell division –In a healthy cell, ras relays a signal to cell when growth factor binds to a receptor, initiating cell division –Mutations in ras occur in more than 30% of human cancers. © 2012 Pearson Education, Inc.

Figure 11.18A Growth factor Target cell Normal product of ras gene Relay proteins Receptor Hyperactive relay protein (product of ras oncogene) issues signals on its own CYTOPLASM DNA NUCLEUS Transcription Translation Protein that stimulates cell division Transcription factor (activated)

p53 - A Tumor Suppressor Gene  p53 is a protein that normally inhibits cell division. –In the absence of functional p53, cell division continues because the inhibitory protein is not produced. –Mutations in p53 occur in more than 50% of human cancers. © 2012 Pearson Education, Inc. Tumor-suppressor gene Mutated tumor-suppressor gene Normal growth- inhibiting protein Cell division under control Defective, nonfunctioning protein Cell division not under control

Figure 11.18B Growth-inhibiting factor Receptor Relay proteins Transcription factor (activated) Nonfunctional transcription factor (product of faulty p53 tumor-suppressor gene) cannot trigger transcription Normal product of p53 gene Transcription Translation Protein that inhibits cell division Protein absent (cell division not inhibited)

DNA Mutations  What is a mutation?  Any change in DNA sequence  May alter function of protein it codes for  Where do mutations come from?  You inherit them from your parents  Inheriting a mutation in a gene that regulates cell cycle leaves you more susceptible to cancer  Errors in DNA replication  Environment  Carcinogens = chemicals that can alter DNA sequence  UV light  X-rays and ionizing radiation © 2012 Pearson Education, Inc.

Importance of somatic DNA changes in human cancer Somatic Inherited Both Only 5 –10% of cancer cases have a clear hereditary component, e.g. BRCA1 and BRCA2 in breast cancer Even in those cases where susceptibility is clearly inherited, somatic changes are required for cancer to develop