Translation Chapter 27 Lecture 21 1

Forms of DNA Helices 2 Post-transcriptional Processing in Eukaryotes

Forms of DNA Helices 3 Post-transcriptional Processing – Modified Bases Uracil DerivativesGuanine DerivativesAdenine Derivatives Pseudouridine  Dihydrouridine (D  N 7 -Methylguanine (m 7 G) (Hoogsteen) N 1 -methylguanine (m 1 G) N 1 -methyladenosine (m 1 A) Inosine (I 

Forms of DNA Helices 4 Post-transcriptional Processing in Eukaryotes This process is facilitated by a huge riboprotein called the Spliceosome

Forms of DNA Helices 5 Prokaryotic Ribosomal RNA Genes are also Processed Ribosomal RNAs are transcribed together in large polycistronic RNAs Primary Processing generates tRNAs and Pre-rRNAs Secondary Processing occurs AFTER ribosomal proteins become associated

Forms of DNA Helices 6 The Genetic Code Highly Degenerate Multiple codons “mean” the same thing Arrangement of the codon table is not random Changing 1 st position tends to produce a similar amino acid (a few exceptions) 2 nd position are mostly hydrophobic (purines mostly polar) Redundancies minimize negative results of mutations Stop codons = UAA, UAG, and UGA Start Codons = AUG (and sometimes GUG)

Forms of DNA Helices The Genetic Code and tRNA Based on the observation that a polypeptide chain sequence is guided by this genetic code, Francis Crick proposed the need for adaptor molecules Transfer RNA (tRNA) is this adaptor. 5’ phosphate at the end of a 7 bp stem 3 or 4 bp stem with a loop that typically has a modified base (Dihydrouridine, D) 5 bp stem terminated by anticodon 5 bp stem terminated by a loop containing TᴪC 5 bp stem terminated by anticodon Terminated by CCA at the 3’ end D-arm Acceptor Stem Anticodon arm ᴪ-arm What amino acid will this code for?

Forms of DNA Helices 8 tRNA Tertiary Structure L-shaped structures with ~60 Å legs Continuous A-Form helix formed by Acceptor and T-stems Helical junction is stabilized by several absolutely conserved base pairs 15 invariant positions (solid circles) Anticodons are ‘looped out’

Forms of DNA Helices 9 tRNA Tertiary Structure

Forms of DNA Helices 10 Predict the Sequence

Forms of DNA Helices 11 Incoming Amino Acid Activation Amino acid is originally activated by ATP to form an aminoacyl-AMP intermediate Incoming tRNA displaces AMP to form an aminoacyl-tRNA Unactivated tRNA

Forms of DNA Helices 12 Aminoacyl-tRNA Synthase Identity Elements Production of Aminoacyl-tRNAs is catalyzed by aminoacyl-tRNA Synthases (aaRS) Each tRNA/amino acid has an independent aaRS dedicated to synthesis of aa-tRNAs Since each of the tRNAs are predicted to look the same, the selectivity must be localized to regions of base variability

Forms of DNA Helices 13 Aminoacyl-tRNA Synthase Acceptor Stem Anticodon Loop D Loop

Forms of DNA Helices 14 Aminoacyl-tRNA Synthase GlnRS forces the acceptor stem to make a sharp turn at the 3’ end This puts the active 3’ OH deep into a cleft where ATP (and presumably Glutamine) binds

Forms of DNA Helices 15 The Ribosome 2.5 MDa complex (in E. coli) Consists of 3 RNA chains 16S  small subunit 23S + 5S  large subunit and 52 proteins 21 associated with small subunit 31 associated with large subunit Sedimentation coefficient (Svedberg Units) Reports on the size and hydrodynamic properties of a particle

Forms of DNA Helices 16 Aminoacyl-tRNA Binding to the Ribosome 3 distinct tRNAs binding sites A site  Aminoacyl site binds incoming aa-tRNA P site  Peptidyl-transfer Site tRNA with growing peptide chain E site  Exit Site tRNA bound that lacks peptide and weakly base paired with mRNA 30S subunit binds mRNA while 50S anchors tRNAs and catalyzes the peptide chain elongation

Forms of DNA Helices 17 Aminoacyl-tRNA Binding to the Ribosome A site  Aminoacyl site binds incoming aa-tRNA P site  Peptidyl Site tRNA with growing peptide chain E site  Exit Site tRNA bound that lacks peptide and weakly base paired with mRNA

Forms of DNA Helices 18 Peptide Elongation at the Ribosome

Forms of DNA Helices 19 Translation Initiation The 16S rRNA contains a purine rich sequence that recognizes a pyrimidine rich sequence ~10 nucleotides downstream from the start codon – Shine Dalgarno Sequence Orientation of mRNA on the ribosome Specialized tRNA for initiation The initial tRNA to insert into the P-site is a formaldehyde modified tRNA

Chain Elongation happens in 3 steps 1.Decoding – ribosomes selects and binds the proper tRNA 2.Transpeptidation – peptide group on the P-site tRNA is transferred to the A-site tRNA 3.Translocation – A-site tRNA transferred to the P-site and P-site tRNA transferred to the E-site Forms of DNA Helices 20 Peptide Elongation at the Ribosome

Forms of DNA Helices 21 Translation Initiation Translation Initiation is a complex process: -30S and 50S subunits are initially separated -IF-3 keeps them from reassembling -mRNA binds to the 30S subunit (guided insertion) -fMet modified tRNA in a complex with IF-2 binds to 30S -This is assisted by IF-1

Forms of DNA Helices 22 Translation Initiation in Eukaryotes eIF4E interaction with 5’cap 2 Trp present planar groove for m 7 G to intercalate H-bonds localized to W-C face and 5’ PP eIF = elongation initiation factors

Forms of DNA Helices 23 Peptide Elongation at the Ribosome Decoding Process EF-Tu forms a complex with GTP (displacing EF-Ts) and the incoming aa-tRNA This complex binds to the empty mRNA at the A Site (energy dependent step) EF-Ts displaces the spent GDP Translocation Process The A-site tRNA displaces the P-site (uncharged) tRNA in an energy dependent process EF-G is the GTPase that hydrolyzes the GTP to promote translocation

Forms of DNA Helices 24 Peptide Termination

What is the anticodon on a tRNA that carries Trp, written 5’ – 3’? A.CCA B.ACC C.UGG D.GGU

What amino acid sequence is encoded in the following mRNA, starting from the start codon? AGCCAUGGACGGGAUUUAAGCAUC A.Ser-His-Gly-Arg-Asp-Leu-Ser- B.Met-Asp-Gly-Ile C.Neither of the above.

Which of the following statements about the genetic code is FALSE? A.The genetic code is described as degenerate because there are more codons than amino acids. B.AUG encodes methionine and is also the start signal for translation. C.Codons in mRNA are “read” by base pairing with anticodons in tRNA. D.Most amino acids are coded by 6 different codons. E.None of these statements are false.

The following sequence is from the template strand of a piece of DNA. What will be the sequence of the corresponding mRNA? A.GGCAUGCAUGCAUG B.GUACGUACGUACGG C.CCGUACGUACGUAC D.CAUGCAUGCAUGCC 5’-GGCATGCATGCATG-3’

Which of the following statements regarding tRNA molecules is false? A.A tRNA may recognize more than one codon. B.All tRNA molecules have 15 invariant positions. C.All tRNA have a 3 CCA sequence which is the site of aminoacylation. D.All tRNA molecules have a 5’ triphosphate. E.All the above statements are true.