PCR-mediated mutagenesis 2015년도 2학기 생화학 실험 (2) 7주차 조교 : 김윤미, 이연

Site-specific mutagenesis 특정 DNA 염기서열에 돌연변이를 도입하는 기법으로 분자생물학의 핵심기술이다. PCR을 응용한 다양한 Site-specific mutagenesis 기법이 개발되었으며 계속 진화하고 있다 (Horton, 1997; Horton et al., 1993) 이를 “PCR-mediated site-directed mutagenesis”라고 한다. 최근 가장 진화한 형태인 “Overlap extension PCR”이 이용되고 있다. (Lee et al., 2004) 1. Single base mutation. 2. Multiple mutation. 3. Insertion. 4. Deletion. The types of mutagenesis. The cause of mutagenesis. 1. UV. 2. Chemical-Carcinogen. 3. Error prone of PCR. 4. Site-directed mutagenesis.

Overlap extension PCR

Overlap Extension PCR  Primer design Sense template (주형) 5’ 541 ttcacatgccctcagtgccgaaagagctttcctcggcggagcttc 586 cgccccaacctgcagctggccaatatggtccaggtgattcggcag 631 atgcacccaacccctggtcgagggagccgcgtgaccgatcagggc 676 atctgtcccaaacaccaagaagccctgaagctcttctgcgaggta 721 gacgaagaggccatctgtgtggtgtgccgagaatccaggagccac 3’ F (Forward)  Anti-sense template와 결합 R (Reverse)  Sense template와 결합 Primer A (F): 5’- atgccctcagtgccgaaagag - 3’ Reverse primer의 경우 주형 template sequence 그대로 design하면 Anti-sense template에 붙기 때문에 상보적인 Sequence로 바꿔주어 sense template에 결합하게함 Primer B (R): 5’- tgattcggcagatgcacccgatcaggg - 3’ 5’- ccctgatcgggtgcatctgccgaatca - 3’ Primer C (F): 5’- agatgcacccgatcagggcatctgtcc - 3’ Primer D (R): 5’- gtgtgccgagaatccaggagc - 3’ 상보적인 Sequence 로 바꿔줌 5’- gctcctggattctcggcacac - 3’

Experimental Procedure : Gel Extraction 1. Agarose gel : membrane binding solution = 10 mg : 10 ㎕ 씩 넣어 55℃ heat block에서 10분간 녹인다. 2. 잘 녹았는지를 vortexing 을 통해 확인 후, sample을 column으로 옮긴다. 3. 14000rpm, 1min centrifuge 4. Wash buffer 750 ㎕ 를 넣은 후 14000rpm, 1 min centrifuge 5. 한번 더 14000rpm, 1 min centrifuge하여 남은 wash buffer를 제거한다. 6. Column을 새 tube에 옮긴 후 D.W.를 30 ㎕ 를 넣고 5분을 기다린다. 7. 14000rpm, 5 min centrifuge

Experimental Procedure : Ligation PCR PCR condition Component Quantity per reaction Targets 1-10kb Distilled water 34.5 ㎕ 5x Herculase II reaction buffer 10 ㎕ dNTP mix 0.5 ㎕ DNA template(A+B) 1 ㎕ DNA template(C+D) Primer A, D Each 1㎕ Herculase II fusion DNA polymerase Total reaction volume 50 ㎕ Temp.(℃) Time 95 2 min 30 sec 55 72 1 min 5 min 30 cycles

Ligation PCR Result

Plasmid DNA Extraction Overlap Extension PCR Cloning Transformation Bacteria culture Plasmid DNA Extraction

PCR fragment for cloning into T-vector PCR polymerase의 종류 Taq DNA polymerase 3’→ 5’ exonuclease (proofreading) activity 없음 3’- A overhang 을 갖음 Pfu DNA polymerase 3’→ 5’ exonuclease (proofreading) activity 있음 Heat stability와 fidelity가 뛰어남 Error rate가 적음

PCR construct (insert) Experimental Procedure 1. T-vector ligation Ingredient Volume ( ul) 2x ligation buffer 5 T-vector 0.5 PCR construct (insert) 3.5 T4 DNA ligase 1 Total 10 Ligation time 1. Overnight at 16 ℃ 2. 1 ~ 2 hours at Room temperature ◈ Ligation volume setting ng of vector ng of insert : = 1 : 5 size of vector size of insert

2. Transformation Experimental Procedure Positive control Self-ligation No insert Control insert (542bp)

Amp/LacZ를 이용한 selection X-gal used to indicate whether a bacterium expresses the β-galactosidase enzyme, which is encoded by the lac Z gene, in a technique called blue/white screening.

3. Bacteria culture Experimental Procedure 16hr 4. Plasmid DNA Extraction  MIDI preparation

Membrane Wash Solution Membrane Binding Solution Report – 결과 및 고찰 1. Gel extraction solution 의 원리 조사 2. Taq polymerase와 Pfu polymerase에 대해 비교 조사 Membrane Wash Solution 1. 10mM potassium acetate (pH 5.0) 2. 80% ethanol 3. 16.7μM EDTA (pH 8.0) Membrane Binding Solution 1. 4.5M guanidine isothiocyanate 2. 0.5M potassium acetate

Report 제출기한 : 2015-10-26 12pm 까지 (늦게 제출 하면 감점) 제출장소: s303 이한웅교수님 연구실 Hand-writing 미 제출 시 0점 처리 조교: 김윤미 (yunmi11144@nate.com)