Cell Surface Targeting. Two routes Protein-protein interfaceDNA-DNA interface.

Slides:

Advertisements

Similar presentations

Protein domain BioBricks Perry Tsai June 19, 2006.

Advertisements

Streptavidin McDevitt, 1999 It binds to biotin.. Streptavidinfo Found in bacteria Streptomyces avidinii Full-length ~160 aa ’ s, core ~ 140 aa ’ s Binds.

Microbial Therapy (Steph, Alex, Sammy) Pathway Engineering - make product body needs (possibly sense deficiency) - Synthetic Symbiosis (E. coli natural.

(DNA-based) cell targeting. Overview Goals 3 designs Possible Implementation Future directions.

DNA aSsEmBlY tEcHnIqUes Design and construct novel biological organisms programmed by genetic circuits using standardized biological parts called BioBricks.

By what mechanisms are calcium signals read and translated into biochemical response? What is the structural basis for the function of the proteins involved?

11 Biobrick Jiale Wang SUSTC. 2 Definition What is Biobrick ? BioBrick standard biological parts are DNA sequences of defined structure and function;

Geobacter Investigating a potential mechanism of Mercury Uptake in Geobacter sulfurreducens.

Enzyme Assays on Chips. Introduction Enzyme assays are used for discovery and characterization of enzymes Identification of protein function instead of.

Microarrays: Tools for Proteomics

Protein-Protein Interaction Screens. Bacterial Two-Hybrid System selectable marker RNA polymerase DNA binding protein bait target sequence target.

Protein Arrays By: Nicole Therrien. Overview What Are Protein Arrays? General Scheme Types of Arrays ◦ Analytical  In-depth  Example ◦ Functional 

Manufacture of Human Interleukin 13 Protein Using a Prokaryotic Expression System Ryan Rupp, York College of Pennsylvania, Department of Biological Sciences.

Expression of clones genes a.o. Primrose & Twyman, 7th edition, pp Primrose, Twyman & Old, 6th edition, pp

 Hepatitis C virus (HCV) infects 170 million people worldwide  up to 80% of those infected become chronic infection.  HCV infection can cause chronic.

Bacillus subtilis expression/secretion systems

Wits_CSIR iGEM 2011/iGEM experience Presenter: Gloria Hlongwane School of Molecular and Cell Biology/ School of Chemical and Metallurgical Engineering,

Lecture 38 Plantibodies.

Cling-E. coli: Bacteria on target A system for targeting bacteria to a specific substrate and effecting a cellular response A system for targeting bacteria.

Cling-E. coli : Bacteria on target Harvard iGEM 2007 Ellenor Brown Stephanie Lo Alex Pickett Sammy Sambu Kevin Shee Perry Tsai Shaunak Vankudre George.

Cling-E. coli : Bacteria on target Harvard iGEM 2007 Ellenor Brown Stephanie Lo Alex Pickett Sammy Sambu Kevin Shee Perry Tsai Shaunak Vankudre George.

Biological Signal Detection for Protein Function Prediction Investigators: Yang Dai Prime Grant Support: NSF Problem Statement and Motivation Technical.

E-beam Size-Dependent Self- Assembly Protein Array.

Transcription control elements (DNA sequences) are binding sites for transcription factors, proteins that regulate transcription from an associated.

Harvard iGEM 2007 Introduction Cling-E. coli : Bacteria on target Harvard iGEM 2007 Ellenor Brown Stephanie Lo Alex Pickett Sammy Sambu Kevin Shee Perry.

Cling-E. coli : Bacteria on target Harvard iGEM 2007 Ellenor Brown Stephanie Lo Alex Pickett Sammy Sambu Kevin Shee Perry Tsai Shaunak Vankudre George.

Cell Surface Targeting

Lecturer: David. * Reverse transcription PCR * Used to detect RNA levels * RNA is converted to cDNA by reverse transcriptase * Then it is amplified.

How many interactions are there? ~6,200 genes ~6,200 proteins x 2-10 interactions/protein ~12, ,000 interactions Yeast.

Rational Design of a Fusion Partner for Membrane Protein

Cling-E. coli : Bacteria on target Harvard iGEM 2007 Ellenor Brown Stephanie Lo Alex Pickett Sammy Sambu Kevin Shee Perry Tsai Shaunak Vankudre George.

Albert Bondt Tessa Sinnige Laurens Vehmeijer.  Introduction  Experiments ◦ Structural studies ◦ Functional studies  Conclusion  Discussion.

Biochemically characterizing the Soluble guanylyl cyclase intrinsically disordered region By: Candice Benally and Colleen Kelley University of Massachusetts.

Cell Surface Targeting 7/31/06. Last Time Identified two potential problems with our procedure –Use human thrombin, not bovine! –Denature aptamers!

Cell Surface Targeting: The week of waiting 8/14/06.

Cling-E. coli : Bacteria on target Harvard iGEM 2007 Ellenor Brown Stephanie Lo Alex Pickett Sammy Sambu Kevin Shee Perry Tsai Shaunak Vankudre George.

Cling-E. coli : Bacteria on target Harvard iGEM 2007 Ellenor Brown Stephanie Lo Alex Pickett Sammy Sambu Kevin Shee Perry Tsai Shaunak Vankudre George.

IGEM 2007 Cell Surface Re-engineering SKS. Outline Cell surface re-engineering Preliminary Results Back to the Drawing Board Outlook.

Fusion Protein Want to Coat Bacteria with Proteins of Interest Surface Display: Fusions to Membrane Proteins Strept Binding Peptides Histidine Tag Random.

Cling-E. coli : Bacteria on target Harvard iGEM 2007 Ellenor Brown Stephanie Lo Alex Pickett Sammy Sambu Kevin Shee Perry Tsai Shaunak Vankudre George.

Cling-E. coli : Bacteria on target Harvard iGEM 2007 Ellenor Brown Stephanie Lo Alex Pickett Sammy Sambu Kevin Shee Perry Tsai Shaunak Vankudre George.

Cell Surface Targeting 8/7/06. Progress/agenda Streptavidin BioBricks –Sequencing for QuikChange-mutagenized single-chain dimer streptavidin showed 141bp.

Sticky Bacteria… Bacteri-adhesive… Cling-E. coli… A working title Perry Tsai June 25, 2007.

Hetmann Hsieh Jeffrey Lau David Ramos Zhipeng Sun.

hisGFPmek and PDZ domain

Fusion Proteins Fusion protein Cleavage of fusion proteins

Addressable Bacterial Conjugation

Fig. 1. The ToxR-based two-hybrid system for the detection of protein–protein interactions in the E.coli periplasm (A) and cytoplasm (B). In fusion with.

Adaptamers Thrombin-binding domain Streptavidin-binding domain

Standard biological parts for synthetic biology

Cell Surface Targeting: An Update.

Harvard iGEM 2006.

Streptavidin on the cell surface

Standard biological parts for synthetic biology

Standard biological parts for synthetic biology

(A) NK cell cytotoxicity assays against K562, H9, and Raji target cell lines in the presence (black) and absence (white) of an anti-NKp30 antibody, clone.

Cling-E. coli Let’s get together: Quorum-sensing

The final constructs, in theory

Atp1a3 surface biotinylation.

The MSP domain of MOSPD2 binds the FFAT motif with an affinity in the micromolar range The MSP domain of MOSPD2 binds the FFAT motif with an affinity in.

Volume 23, Issue 4, Pages (April 2015)

Volume 28, Issue 6, Pages (December 2007)

CED-1 is a protein that localizes to the plasma membrane

Adaptamers Target A Target B Adaptamer.

Volume 5, Issue 4, Pages (October 2017)

Dual Function of the Voltage-Dependent Ca2+ Channel α2δ Subunit in Current Stimulation and Subunit Interaction Christina A Gurnett, Michel De Waard,

A, scheme of the APC cDNA and the mutant APC cDNAs which were used for reporter gene assays. A, scheme of the APC cDNA and the mutant APC cDNAs which were.

Registry of Parts:

a. a. 35–47 mediate the binding of mCRP to CFH in ELISAs

Presentation transcript:

Cell Surface Targeting

Two routes Protein-protein interfaceDNA-DNA interface

Protein-protein

Protein domain BioBricks 5’ GTTTCTCCGAATTCGCGGCCGCTTCTAGAG EcoRI XbaI TACTAGTAGCGGCCGCTGCAGGGAGAAAC 3’ SpeI PstI Standard part 5’ GTTTCTCCGAATTCGCGGCCGCTTCTAGA EcoRI XbaI ACTAGTAGCGGCCGCTGCAGGGAGAAAC 3’ SpeI PstI Protein domain 5’ GTTTCTCCGAATTCGCGGCCGCTTCTAGA EcoRI XbaI ACTAGTAGCGGCCGCTGCAGGGAGAAAC 3’ SpeI PstI Domain assembly ACTAGA ThrArg Mixed

Streptavidin Found in bacteria Streptomyces avidinii Full-length ~160 aa’s, core ~ 140 aa’s Binds strongly to biotin (vitamin H or B7) –K d ~ M (Chaiet, 1964) No cysteines, no carbohydrates, no charge McDevitt, 1999

Lpp-OmpA surface expression Lipoprotein (Lpp): major outer membrane protein (most abundant protein in E. coli by numbers); targeted to outer membrane Outer membrane protein A (OmpA): well-characterized eight-strand beta-barrel transmembrane domain; stable surface xpression Lpp 20aa signal peptide + Lpp aa OmpA aa surface protein OmpA also successful Bla, Fv fragments, OPH, Cex (C. fimi) Goal: Use Lpp-OmpA to express streptavidin on the surface to bind biotinylated DNA or protein to the membrane Francisco et al., 1992

Progress/agenda Created BioBricks of three streptavidin clones from Ting lab: wild-type, wild-type + His6 tag, dead mutant Created BioBricks of full Lpp and OmpA, then Lpp(1-29), OmpA(46-66), OmpA(46-159) More BioBricks: single-chain dimer streptavidin from Aslan lab Assembly and expression of Lpp-OmpA-streptavidin

DNA-DNA

Aptamers Short DNA/RNA sequences that have high specificity and affinity for substrate Low generation time

Pros –Potential control of binding kinetics and thermodynamics –Control of relative amounts of different substrates that bind cell surface –Swappable Cons –Interaction strength limited by strength of aptamer- protein interactions

First designs

Progress Have begun to characterize DNA-DNA interaction Gel shift assays have failed to prove that aptamers are binding the proteins For the future: more promising assays.