High-Throughput Screening Core Facility at CU-Boulder Wei Wang 06-01-2015.

Slides:

Advertisements

Similar presentations

Dr Claes Wilhelmsson Executive Director Research & Development Innovation and the life sciences.

Advertisements

The Drug Discovery Process

David M. Pollock Medical College of Georgia Discovery-Academia.

Challenges in new drug discovery in South Asia

The Division of Monoclonal Antibodies Kathleen A. Clouse, Ph.D., Director CTGTAC - July 26, 2007.

Chemical Biology 1 – Pharmacology Methods for studying protein function – Loss of Function 1. Gene knockouts 2. Conditional knockouts 3. RNAi.

Anchored Periplasmic Expression (APEx) A Powerful Technology for Antibody Discovery and Combinatorial Protein Library Screening George Georgiou, Dept.

Screening Tyrosine Kinase Inhibitors Targeting Pancreatic Cancer: Validation of Assays on Platelet Derived Growth Factor Receptor Gy. Bökönyi 3, E. Várkondi.

Drug Discovery Resources at Purdue

Jeffery Loo NLM Associate Fellow ’03 – ’05 chemicalinformaticsforlibraries.

What Challenges? How do we prepare students for a career in Pharmacology? How do we combine elements of “traditional pharmacology with modern concepts.

NA shell NA shell vPFC mVP VTA NA core NA core dPFC SN dVP Blockade in these regions blocks relapse or reinstatement Drug Seeking Behavior – Motor Subcircuit.

Chemical Genetics – Biol503

Biol518 Lecture 2 HTS and Antibiotic Drug Discovery.

Super fast identification and optimization of high quality drug candidates.

1111 Discovery Novel Allosteric Fragment Inhibitors of HIV-1 Reverse Transcriptase for HIV Prevention A/Prof Gilda Tachedjian Retroviral Biology and Antivirals.

Doug Brutlag 2011 Genomics, Bioinformatics & Medicine Drug Development

Discovery of new medicines through new models of collaboration Simon Ward Professor of Medicinal Chemistry & Director of Translational Drug Discovery Group.

Molecular Library and Imaging Francis Collins, NHGRI Tom Insel, NIMH Rod Pettigrew, NIBIB Building Blocks and Pathways Francis Collins,NHGRI Richard Hodes,

The NIH Roadmap for Medical Research

The South African Malaria Initiative A Case Study E Jane Morris Bridging the Gap in Global Health Innovation - from Needs to.

Bradley Moore Natural Products, Genomics, Drug Discovery Currently funded projects: 1. Bioengineering marine antibiotics (NIAID – R01) 2. Biosynthesis.

Pharmacology embraces knowledge of the sources, chemical properties, biological effects and therapeutic uses of drugs. In general terms, pharmacology.

GGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTAC CCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGG

Combinatorial Chemistry and Library Design

U.S. DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of Neurological Disorders and Stroke U.S. DEPARTMENT OF HEALTH.

Asia’s Largest Global Software & Services Company Genomes to Drugs: A Bioinformatics Perspective Sharmila Mande Bioinformatics Division Advanced Technology.

Genome-scale Metabolic Reconstruction and Modeling of Microbial Life Aaron Best, Biology Matthew DeJongh, Computer Science Nathan Tintle, Mathematics Hope.

Probe into Discovery and Translational Service in Creative BioMart

Chapter 13. The Impact of Genomics on Antimicrobial Drug Discovery and Toxicology CBBL - Young-sik Sohn-

Grand Challenges for Nanomedicine and Nanobiology Workshop Houston, Texas August 27 th, 2007.

Introduction to Chemoinformatics Irene Kouskoumvekaki Associate Professor December 12th, 2012 Biological Sequence Analysis course.

ACCELERATING CLINICAL AND TRANSLATIONAL RESEARCH Notre Dame: Drug Discovery Expertise and Resources Chemical Structure and Synthetic.

Genome Research Institute University of Cincinnati.

Bill Gerwick Research Interests Characterizing the ‘weird and wonderful’ natural products of marine algae and cyanobacteria Drug discovery from marine.

Drug Discovery Process Massimiliano Beltramo, PhD.

Function first: a powerful approach to post-genomic drug discovery Stephen F. Betz, Susan M. Baxter and Jacquelyn S. Fetrow GeneFormatics Presented by.

Samudrala group - overall research areas CASP6 prediction for T Å C α RMSD for all 70 residues CASP6 prediction for T Å C α RMSD for all.

Receptor/enzymes. Drug Design Most drugs work on proteins Somehow interfere with a biochemical process –Can shut down –Can activate.

Intellectual Property Rights and Pharmaceutical Industry

Pathogenomics How this project began: Ann Rose - take advantage of DNA sequence information - genomics Julian Davies - use the information to understand.

ECCR Overview/MLSCN. NIH Roadmap Series of initiatives designed to pursue major opportunities in biomedical research and gaps in current knowledge that.

A general method for screening of peptidomimetic libraries by ELISA based tyrosine kinase assay Gy. Bökönyi 1, E. Schäfer 2, E. Várkondi 2, Edit Z. Szabó.

GRANT WRITING FOR SUCCESS: TOP 10 REVIEWER CONCERNS AND GOOD/BAD GRANTS Grant Writing for Success LeShawndra N. Price, Ph.D., NIMH, NIH Henry Khachaturian,

Introduction to Chemoinformatics and Drug Discovery Irene Kouskoumvekaki Associate Professor February 15 th, 2013.

PubChem: An Open Repository for Chemical Structure and Biological Activity Information Steve Bryant The NIH Biowulf Cluster: 10 Years of Scientific Supercomputing.

Discovery of Therapeutics to Improve Quality of Life Ram Samudrala University of Washington.

Basic Translational Clinical New Pathways to Discovery Harmonization Target ID & Valid. Phases I-III Research Teams of Future Translational Cores Clinical.

Today’s Drug Discovery Process “How Do We Discover Drugs” Dr. Vincent P. Gullo Drew University.

A model collaboration using the Pool Susanne Hollinger, Ph.D., J.D. Chief Intellectual Property Officer Emory University.

A truly integrated drug discovery company 26 th April 2016 CONFIDENTIAL.

Elon Yariv Graduate student in Prof. Nir Ben-Tal’s lab Department of Biochemistry and Molecular Biology, Tel Aviv University.

RAS Initiative at the Federally Funded Research and Development Center at Frederick Presented By: Sara S. Hook October 1, 2015.

신기술 접목에 의한 신약개발의 발전전망과 전략 LGCI 생명과학 기술원. Confidential LGCI Life Science R&D 새 시대 – Post Genomic Era Genome count ‘The genomes of various species including.

Pharmaceutical Approaches to Antiviral Drug Discovery

전통적인 신약 개발 과정.

Strathclyde’s natural products and assay facilities SIDR.

U.S. DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of Neurological Disorders and Stroke Big Discoveries, Small.

 Facilities Open House Functional Genomics Facility Molishree Joshi, Ph.D. 6/1/2015 Contact Information:

Page 1 Computer-aided Drug Design —Profacgen. Page 2 The most fundamental goal in the drug design process is to determine whether a given compound will.

Today’s Drug Discovery Process “How Do We Discover Drugs”

Can Drug Discovery Research be Done At An Undergraduate Institution?

SEMINAR 1. Title : Discovery of Protein-Protein Interaction Modulators Using Affinity-Based High-Throughput Screening 2. Speaker : Hyun-Suk Lim (포항공대 (POSTECH))

Action: BM0806 Recent Advances in Histamine Receptor H4R Research

Ligand-Based Structural Hypotheses for Virtual Screening

Institute of Molecular Biophysics

Fast in vitro Kinetic Assays with

Drug Design and Drug Discovery

How Chemoproteomics Can Enable Drug Discovery and Development

PhD date: 1994, Weizmann Institute of Science Research topics:

Presentation transcript:

High-Throughput Screening Core Facility at CU-Boulder Wei Wang

HTS Core Facility Mission and Services Our mission is to promote chemical biology research and drug discovery at CU-Boulder and surrounding areas. We offer assistance on all steps involved in typical drug-discovery processes: 1. Assay development and validation 2. High-throughput screening 3. Data analysis, validation and lead identification 4. Structure and activity relationship (SAR) studies and large-scale production 5. In silico screen (we offer access to Schrodinger Suite )Schrodinger Suite and post-screen cheminformatic analysis

Compound Libraries and Instrumentation -FDA-approved drug library: 1,200 compounds (Prestwick Chemical) -Kinase- or protease-targeted library: 2,100 compounds (Biofocus) -Drug-like diversity library: 14,400 compounds (Maybridge HitFinder v11) -Drug-like diversity library: 10,000 compounds (ChemBridge) -Drug-like diversity library: 10,000 compounds (TimTec)

ScreenLibraryAssayTestPilotHTSHits Optimization RunScreen Validation Screen for inhibitors of PinK1-Parkin Kinase- & pathway (Liu Lab) protease-targeted Screen for agonists of Toll-like receptors (Yin Lab)Maybridge Screen for molecules that selectively potentiate the activity of β-lactamIndole alkaloids antibiotics in MRSA (Wang Lab) Screen for agonists of TLR5Maybridge (Yin Lab) Screen for antagonists of TLR5Maybridge (Yin Lab) Screen for agonists of TLR3Maybridge (Yin Lab) Screen for antagonists of TLR8Maybridge (Yin Lab) Summary of Recent Screens (I)

ScreenLibraryAssayTestPilotHTSHits Optimization RunScreen Validation Screen for JHDM1-class-selectiveMaybridge inhibitors (Facility and Wang Lab) Screen for agonists of TLR2 (Yin Lab) Maybridge Screen for antagonist of TLR2Maybridge (Yin Lab) Screen for antagonists of TLR7Maybridge (Yin Lab) Screen for compounds that disrupt replication of salmonella inside host Maybridge macrophages (Detweiler Lab) Screen for compounds that block MED1Maybridge and Tra interaction (Taatjies Lab) Screen for offshoots of type1 IFN signaling pathway that is responsible for suppressing response to IFNg FDA-approved drug library (Lenz Lab) Summary of Recent Screens (II)

YearAwardLabInstitute 2013Golfers Against Cancer Award Taatjes and Wang Dept. of Chem & Biochem 2014Bioscience Discovery Evaluation Grant Johnson Institute of Behavioral Genetics 2015Innovative Seed Grant DetweilerMCDB NIH R21/R33 LenzDept. of Immunology and Microbiology, CU Anschutz Awarded Grants and Funding Opportunities NIH high throughput screening funding opportunities: Development of Assays for High-Throughput Screening for Use in Probe and Pre- therapeutic Discovery (R01) (PAR )(PAR ) High Throughput Screening (HTS) to Discover Chemical Probes (R21) (PAR )(PAR ) High Throughput Screening (HTS) to Discover Chemical Probes (R01) (PAR ) (PAR )

Contact Us UCB215 Department of Chemistry and Biochemistry University of Colorado-Boulder Boulder, CO Wei Wang Manager Office: Xiang Wang Director Office: