1 The Central Dogma of Biology PROTEIN SYNTHESIS
DNA DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells 2
3 Genes & Proteins Proteins are made of amino acids linked together by peptide bonds 20 different amino acids exist
4 Amino Acid Structure copyright cmassengale
5 Polypeptides Amino acid chains are called polypeptides
6 DNA Begins the Process DNA is found inside the nucleus Proteins, however, are made in the cytoplasm of cells by organelles called ribosomes Ribosomes may be free in the cytosol or attached to the surface of rough ER
7 Starting with DNA DNA ‘s code must be copied and taken to the cytosolDNA ‘s code must be copied and taken to the cytosol In the cytoplasm, this code must be read so amino acids can be assembled to make polypeptides (proteins)In the cytoplasm, this code must be read so amino acids can be assembled to make polypeptides (proteins) This process is called PROTEIN SYNTHESISThis process is called PROTEIN SYNTHESIS
8 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan
9 Structure of RNA copyright cmassengale
10 Messenger RNA (mRNA) Carries the information for a specific proteinCarries the information for a specific protein Made up of 500 to 1000 nucleotides longMade up of 500 to 1000 nucleotides long Sequence of 3 bases called codonSequence of 3 bases called codon AUG – methionine or start codonAUG – methionine or start codon UAA, UAG, or UGA – stop codonsUAA, UAG, or UGA – stop codons copyright cmassengale
11 The Genetic Code A codon designates an amino acid An amino acid may have more than one codon There are 20 amino acids, but 64 possible codons Some codons tell the ribosome to stop translating copyright cmassengale
12 The Genetic Code Use the code by reading from the center to the outside Example: AUG codes for Methionine copyright cmassengale
13 Name the Amino Acids GGG? UCA? CAU? GCA? AAA? copyright cmassengale
14
15 Remember the Complementary Bases On DNA: A-T C-G On RNA: A-U C-G
16 Transfer RNA (tRNA) Clover-leaf shape Single stranded molecule with attachment site at one end for an amino acid Opposite end has three nucleotide bases called the anticodon
17 Transfer RNA amino acid attachment site UAC anticodon
18 Codons and Anticodons The 3 bases of an anticodon are complementary to the 3 bases of a codon Example: Codon ACU Anticodon UGA UGA ACU
Transcription and Translation 19
20 Pathway to Making a Protein DNAmRNA tRNA (ribosomes) Protein
21 Protein Synthesis The production or synthesis of polypeptide chains (proteins) Two phases: Transcription & Translation mRNA must be processed before it leaves the nucleus of eukaryotic cells
22 DNA RNA Protein Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell copyright cmassengale
23 Transcription The process of copying the sequence of one strand of DNA, the template strand mRNA copies the template strand Requires the enzyme RNA Polymerase
24 Template Strand copyright cmassengale
25 Question: What would be the complementary RNA strand for the following DNA sequence? DNA 5’-GCGTATG-3’
26 Answer: DNA 5’-GCGTATG-3’DNA 5’-GCGTATG-3’ RNA 3’-CGCAUAC-5’RNA 3’-CGCAUAC-5’
27 mRNA Transcript mRNA leaves the nucleus through its pores and goes to the ribosomes
28 Translation Translation is the process of decoding the mRNA into a polypeptide chain Ribosomes read mRNA three bases or 1 codon at a time and construct the proteins
29 Messenger RNA (mRNA) methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon Primary structure of a protein aa1 aa2aa3aa4aa5aa6 peptide bonds codon 2codon 3codon 4codon 5codon 6codon 7codon 1 copyright cmassengale
30copyright cmassengale