Molecular analysis of Rabies virus circulating in terrestrial mammals in the Slovak Republic R. Franka 1,2, M.Mojzis 2, I. Kuzmin 1, A. Velasco Villa 1,

Slides:



Advertisements
Similar presentations
1 Molecular epidemiology of lyssaviruses in Eurasia Dr Lorraine McElhinney Veterinary Laboratories Agency (Weybridge), UK.
Advertisements

Epidemiology of Rabies in Southeast Europe
NATIONAL VETERINARY RESEARCH INSTITUTE, PULAWY, POLAND Towards the Elimination of Rabies in Eurasia, Paris, May 2007 RABIES SURVEILLANCE IN POLAND.
SYLVATIC RABIES IN RUSSIA WITH SPECIAL ATTENTION TO PERSPECTIVES OF ORAL VACCINATION OF WILD CARNIVORES A. Botvinkin, D. Bankovsky, G. Safonov Irkutsk.
EPIDEMIOLOGY AND CONTROL OF RABIES IN IRAN. No of persons received PrP.
1 Towards the elimination of Rabies in Eurasia Jean Blancou, WOAH, May
Identification of novel canine rabies clades in the Middle East and North Africa Dan David Rabies Laboratory, Pathology Division, Kimron Veterinary Institute,
Human rhinovirus species occurrence among adults with respiratory tract infection and asymptomatic individuals during two consecutive winter seasons Zlateva.
WRLFMD Identification of a Ninth Foot-and-Mouth Disease Virus Type O Topotype and Evidence for a Recombination Event in its Evolution Nick J. Knowles,
By: Garrett Hu. Lyssaviruses are RNA viruses that has RNA as its genetic material that infect mammals and causing rabies-like diseases. Example of diseases.
Rabies Surveillance in the United States During 2012 Division of High-Consequence Pathogens and Pathology Poxvirus and Rabies Branch March 2014 National.
Identification of an informative and accurate region of the HCV genome for phylogenetic analyses Patrik Medstrand Clinical Virology.
HIV/AIDS as a Microcosm for the Study of Evolution.
Materials and Methods Abstract Conclusions Introduction 1. Korber B, et al. Br Med Bull 2001; 58: Rambaut A, et al. Nat. Rev. Genet. 2004; 5:
Out-of-Africa Theory: The Origin Of Modern Humans
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.
HIV-1 subtype C now accounts for approximately 50% of the estimated 33 million people living with HIV/AIDS and half of the 1-2 million new infections annually.
Molecular evidence for endosymbiosis Perform blastp to investigate sequence similarity among domains of life Found yeast nuclear genes exhibit more sequence.
 Read Chapter 4.  All living organisms are related to each other having descended from common ancestors.  Understanding the evolutionary relationships.
PHYLOGENETICS CONTINUED TESTS BY TUESDAY BECAUSE SOME PROBLEMS WITH SCANTRONS.
Phylogeny GENE why is coalescent theory important for understanding phylogenetics (species trees)? coalescent theory lets us test our assumptions.
Analysis of Mitochondrial DNA from Chimpanzees in Tanzania Timothy Comar, April Bednarski, and Douglas Green.
Rabies. Symptoms flu-like symptons (couple days initially)  general weakness, discomfort, fever, headache discomfort or itching at bite location later.
Human Genomics. Writing in RED indicates the SQA outcomes. Writing in BLACK explains these outcomes in depth.
Nada M. Melhem, PhD American University of Beirut
Canine Rabies Elimination from the United States: an Epidemiological and Virological Perspective Canine Rabies Elimination from the United States: an Epidemiological.
Risk of rabies introduction by non- commercial movement of pets Case study: ROMANIA.
Jelena Prpić, B.Sc., PhD Croatian Veterinary Institute.
National Center for Emerging and Zoonotic Infectious Diseases Division of High-Consequence Pathogens and Pathology Rabies Surveillance in the United States.
Rabies Surveillance in the United States During 2013 Division of High-Consequence Pathogens and Pathology Poxvirus and Rabies Branch December 2015 National.
GF-TADs for Europe Steering Committee meeting EU rabies Projects: Progress report AFSCA - Brussels – 1 October 2015.
Rabies, A Threat to Biodiversity
Session 3: Molecular Epidemiology Introduction
Introduction to Bioinformatics Resources for DNA Barcoding
Genetic diversity of Anaplasma phagocytophilum and reservoir competence of wild life animals for tick-borne pathogens in northern Italy.   Ivana Baráková1,2,
Comparative genotypic and phenotypic characterization of
Figure 1. Lineages circulating in sampled regions
RESULTS AND DISCUSSION
Pipelines for Computational Analysis (Bioinformatics)
The Evolution and Speciation of Plasmodium spp. Among Primates
C. G. Gitao S. M. Kihu, L. C. Bebora, J. M. Njenga, G. G. Wairire N
Latifah Ibrahim, Normaznah Yahaya, Amal Nasir Mustafa.
Gene-sequence analysis reveals at least three species hidden in Zausodes arenicolus Erin Easton November 13, 2008.
Results and Conclusions
Molecular surveillance of measles and rubella in the WHO European Region: new challenges in the elimination phase  S. Santibanez, J.M. Hübschen, M.C.
H. Un, N. Johnson, A. Vos, T. Muller, A.R. Fooks, O. Aylan 
Genetic detection of Dobrava/Belgrade virus in a Czech patient with Haemorrhagic fever with renal syndrome  A. Papa, H. Zelená, D. Barnetová, L. Petroušová 
E. Descloux, C. La Fuentez, Y. Roca, X. De Lamballerie 
Characterization of FMDV isolates from Sudan collected from outbreaks
Volume 25, Issue 24, Pages (December 2015)
West Nile virus outbreak in Israel in 2015: phylogenetic and geographic characterization in humans and mosquitoes  Y. Lustig, Z. Kaufman, B. Mannasse,
O. Adam, A. El Hussein, A. El Eragi, L. Jin 
A Web-based Interactive Genome Library for Surveillance, Detection, Characterization and Drug-Resistance Monitoring of Influenza Virus Infection in the.
A. Papa, K. Dumaidi, F. Franzidou, A. Antoniadis 
Genetic variability of wild-type measles viruses, circulating in the Russian Federation during the implementation of the National Measles Elimination.
Male patient with acute hepatitis E in Genoa, Italy: figatelli (pork liver sausage) as probable source of the infection  A.R. Garbuglia, A.I. Alessandrini,
Next-generation sequencing technology in clinical virology
Genotyping and origin of the emergent U. S
Fig. 4 Phylogeny of rabies strains isolated during and after the mass vaccination campaign. Phylogeny of rabies strains isolated during and after the mass.
Lauren M. Mathews, Susan Y
A. Papa, K. Xanthopoulou, S. Gewehr, S. Mourelatos 
Analysis of the complete genome sequences of human rhinovirus
Advances in Understanding Bacterial Pathogenesis Gained from Whole-Genome Sequencing and Phylogenetics  Elizabeth Klemm, Gordon Dougan  Cell Host & Microbe 
Genetic and genomic comparisons of the African B
Molecular epidemiology and genetic diversity of human astrovirus in South Korea from 2002 to 2007  A.Y. Jeong, H.S. Jeong, M.Y. Jo, S.Y. Jung, M.S. Lee,
F.M. Cohan  Clinical Microbiology and Infection 
Novel West Nile virus lineage 1a full genome sequences from human cases of infection in north-eastern Italy, 2011  L. Barzon  Clinical Microbiology and.
Neonatal HSV-2 genomes are genetically distinct from one another and encompass a broad range of known HSV-2 genetic diversity. Neonatal HSV-2 genomes are.
Rapid Detection of HIV-1 subtype C Integrase resistance mutations by the Use of High-Resolution Melting Analysis Tendai Washaya BSc, Msc. Pre-PhD Student.
Evolution Biology Mrs. Johnson.
Presentation transcript:

Molecular analysis of Rabies virus circulating in terrestrial mammals in the Slovak Republic R. Franka 1,2, M.Mojzis 2, I. Kuzmin 1, A. Velasco Villa 1, P. Yager 1, S. Jerg 2 and C.E.Rupprecht 1 1 Centers for Disease Control and Prevention, 1600 Clifton Road NE, Atlanta, GA, USA 2 State Veterinary Institut Zvolen, National Reference Laboratory for Rabies, Slovak Republic 4. Results 3. Material and Methods 2. Introduction 1. Abstract Rabies of terrestrial mammals remains a problem in eastern Europe despite active oral vaccination campaigns. To date, the red fox (Vulpes vulpes) and the raccoon dog (Nyctereutes procyonoides) are the main hosts of rabies virus (RABV) in Europe. In this preliminary study, we sequenced part of the nucleoprotein (N) gene of RABV, obtained from 22 red foxes, 6 cats, 1 wild cat, 4 dogs, 2 lynxes, 1 goat, 4 stone martens, 1 fitch and 1 badger collected during 2000 to 2003 in the Slovak Republic. A phylogenetic analysis was undertaken, using for comparison RABV sequences originating from terrestrial animal species from other European countries, which were available from GenBank. Sequences were edited using BioEdit software, and multiple alignments were carried out using the Clustal X package. Neighbor joining analysis for 1000 bootstrap replicates was performed using MEGA version 2.1. The analysis revealed that 96% of RABV samples were related with the lineage previously described as the ‘Eastern Europe’ group (EE). The remaining 4% were joined to the lineage described as the ‘Central Europe’ group (CE). No significant associations with the year of occurrence, host species, or a particular geographic location were found within the set of Slovak samples analyzed. In our set of data we did not identify isolates similar to the vaccine strain SAD-Bern which is currently used for oral rabies vaccination in the country. Key words: rabies, phylogenetic, Slovakia, Slovak Republic, epizootiology, epidemiology, 5. Conclusions LITERATURE CITED The main hosts of the rabies in Europe are the red fox (Vulpes vulpes) and the raccoon dog (Nyctereutes procyonoides), with only sporadic human cases registered in European countries over the last few decades, mainly because of successfully implemented oral vaccination programs and advanced human post-exposure prophylaxis (Toma and Andral, 1977; Bourhy et al., 1999). In the western part of Europe, with the exception of Germany, rabies of terrestrial mammals was successfully eliminated. However, the disease remains enzootic in the eastern part of Europe despite active oral vaccination campaigns. Previous phylogenetic studies have demonstrated an intrinsic molecular diversity of rabies virus variants (Kissi et al., 1995; Bourhy et al., 1999, Kuzmin et al., 2004). Phylogenetic analyses of the rabies virus circulating in European terrestrial mammals showed four geographically defined groups: Western Europe (WE), Central Europe (CE) and Eastern Europe (EE) with the red fox as predominant host; and North- Eastern Europe (NEE) with the red fox and raccoon dog as predominant hosts (Bourhy et al., 1999). Oral vaccination campaigns in a few districts of Slovakia were first implemented during and extended nationwide since The first strain used for oral vaccination was Vnukovo-32/107, later replaced by an oral vaccine based on the SAD Bern strain. Despite the oral vaccination campaign, rabies remains enzootic in Slovakia. Red foxes are the only rabies reservoir with frequent spill-over mostly to wildlife and to a lesser extent to domestic animals. The goal of our study was to describe the molecular diversity of rabies virus circulating in different species of terrestrial mammals in the Slovak Republic and to compare them with other lineages circulating in different regions of Europe. BLANCOU, J., M.F.A. AUBERT AND M. ARTOIS Fox rabies. In: The Natural History of Rabies. G.M. BAER (ed.) Boca Raton. CRC Press, pp. 257–290. BOURHY, H., B. KISSI, L. AUDRY, M. SMRECZAK, M. SADKOWSKA-TODYS, K. KULONEN, N. TORDO, J.F. ZMUDZINSKI, AND E.C. HOLMES Ecology and evolution of rabies virus in Europe. Journal of General Virology 80: DEAN, D.J., M.K. ABELSETH, AND P. ATANASIU The fluorescent antibody test. In: Laboratory techniques in rabies, 4th Edition, F.-X. MESLIN, M.M. KAPLAN, AND H. KOPROWSKI (eds.). World Health Organization, Geneva, Switzerland, pp HOLMES, C.E., C.H. WOELK, R. KASSIS AND H. BOURHY Genetic constraints and the adaptive evolution of rabies virus in nature. Virology 292:247 – 257. KISSI, B., N. TORDO, H. BOURHY Genetic polymorphism in the rabies virus nucleoprotein gene. Virology 209: 526 – 537. KUZMIN, I.V., A.D. BOTVINKIN, L.M. McELHINNEY, J.S. SMITH, L.A. ORCIARI, G.H. HUGHES, A.R. FOOKS and C.E. RUPPRECHT Molecular epidemiology of terrestrial rabies in the former Soviet Union. Journal of Wildlife Disease 40(4): TISCHENDORF, L., H. THULKE, C. STAUBACH, M.S. MULLER, F. JELTSCH, J. GORETZKI, T. SHELHORST, T. MULLER, H. SCHLUTER AND C. WISSEL Chance and risk of controlling rabies in large-scale and long-term immunized fox populations. Proc. R. Soc. Lond. 265:839–846. TOMA, B., AND L. ANDRAL Epidemiology of fox rabies. Advances in Virus Research 21:1–36. TRIMARCHI, C.V. AND J.S. SMITH Diagnostic evaluation. In: Rabies. JACKSON A.C. AND W.H. WUNNER. Academic Press, pp Samples from different species of terrestrial mammals from different regions of the Slovak Republic, collected during 2000 – 2003, were initially screened by the direct fluorescent antibody test (Dean et al., 1996) (Fig.1). Total RNA was extracted from 42 positive brains using TRIzol® Reagent (Invitrogen). The reverse transcriptase polymerase chain reaction (RT-PCR) was performed with a primer set to nucleoprotein (N) gene – 21g and 304 (Trimarchi and Smith, 2002). A fragment of 940nts within the coding region of the N gene (position 70 – 1010 according to PV strain), obtained from 42 different terrestrial animals (22 red foxes, 6 cats, 1 wild cat, 4 dogs, 2 lynxes, 1 goat, 4 stone martens, 1 fitch and 1 badger), was sequenced. The phylogenetic analysis was undertaken by the Neighbor Joining method using the MEGA computer program, version 2.1. For comparison, RABV sequences originating from different mammals from Europe, Asia and Africa, available from GenBank, were included. European bat lyssavirus sequences were used as an outgroup (Bourhy et al., 1999; Kuzmin at al., 2004). Bootstrap values of more than 70% were regarded as providing support for phylogenetic grouping. Identical or highly similar samples from Slovakia were excluded from the tree and only representatives from each subgroup were left.  96% of RABV samples belonged to one clade previously described as the ‘Eastern Europe’ (EE) group, and the remaining 4% were joined to the lineage described as the ‘Central Europe’ (CE). The statistical support observed for these two groups was 95% and 99%, respectively (Fig. 2). The phylogeny showed clear separation between the EE and north-eastern Europe (NEE) clade (Bourhy et al., 1999), which might be explained by the existence of a physical barrier – Carpathian mountain (High Tatras) on the north border of the Slovak Republic and Poland. Thus, the Slovakian isolate 94250SLK collected from a cat in 1994, described by Bourhy et al. (1999) as a member of NEE clade, could be explained as the result of translocation of the animal through the mountain barrier.  The sequence identity of the Slovakian samples with respect to other EE clade members collected over 17 years ranged between 98% and 100%, for the nucleoprotein gene fragment studied.  We have not found any significant differences according to the year of occurrence, host species, or a particular geographic location within eastern Europe.  In our dataset we did not identify isolates similar to the vaccine strain SAD-Bern used for oral rabies vaccination in the country.  No spill-over of European Bat Lyssaviruses from bats to terrestrial mammals was detected in our dataset.  Most of the rabies viruses circulating in different terrestrial mammals in Slovakia belong to the eastern Europe (EE) group.  Absence of distinctions among EE isolates as regards host species or geographic origin suggests that the isolates belong to one circulation circle. Additionally, this virus lineage has been considerably constrained over at least 17 years.  Presence of members of Central Europe (CE) group in the eastern part of the Slovak Republic is surprising and could suggest that this clade is dispersed over a wider geographical area.  Neither vaccine virus, nor European bat lyssavirus spill-overs were detected in our limited dataset. Fig.2 Neighbor joining phylogenetic tree of the 54 rabies virus isolates according to a 940 nucleotide fragment of the nucleoprotein gene (position 70 – 1010 according to PV strain, accession number: M13215). Bootstrap values are presented for the key nodes, and branch lengths are drawn to scale. Isolates from Slovak Republic are bolded. Abbreviations for the isolates from Slovakia are as follows: abbreviation for city isolation followed by id number and two numbers indicating year of collection, followed by specification of species from which samples were collected. Abbreviations for earlier described European and Asian groups (NEE, CE, EE, WE, and A, B, C, D) are given according to Bourhy et al. (1999) and Kuzmin et al. (2004) respectively. SAD Bern is the vaccine strain used for oral vaccination in Slovakia. Fig.1 Locations where samples for our study were collected during period FRA74fox 86111YOU86fox 9244FRA92fox 8618POL85raccoondog 9212ALL91fox 9202ALL91fox PO17003fitch PO1903fox 8653YOU86wolf KE14800fox DK24800fox ZV35501cat BA16300fox KE29000cat DK7200fox KE16100cat ZV6601cat ZV21403stonemarten NR19902goat ZV40301lynx NR700fox ZV254003badger RV1596RUSfox 9142EST85raccoondog 9342EST91raccondog 9339EST91raccoondog 3683cRUSsteppefox RV299RUSfox 8681IRAdog 8702IRAwolf 8706ARSfox 9135OMAfox 86107YOU76fox 8658YOU81cattle 8721AFS81human 8807ETH87hyena 9137ALG82dog PV SAD Bern SAD B19 CVS ERA 857rRUSraccoondog KomatsugawaJAPdog 304cRUSsteppefox 9105CAN90fox 4055CANdog RVHKRushuman 9141RUS88arcticfox RV250Rusrodent 8738THAhuman 9007FIN 8615POL EBL1aSK98eserotinus Western Europe Central Europe Eastern Europe North-Eastern Europe Middle East Laboratory vaccine strains Africa 1 B –Arctic like A –Arctic C D European part of Russia EBL 1 EBL 2 South Euro-Asia