8.5 Translation Updates: 8.4 due Homework: –Shopping: buy highlighters (2 colors) –Genes questions due Thursday Quizzes continue tomorrow: 8.2, 8.4 Midterm: Pd 2-3, 7-8 Tues 1/19, 6-7 Wed 1/20 AAP: Tuesday and Thursday
8.5 Translation LEQ: How is genetic information transcribed? Activator: lines –3 important things to remember about the central dogma and gene expression –2 things you don’t understand –1 question to ask Key terms – transcription
8.5 Translation Article: Highlight important parts of the article (less is better) Circle words you do not understand Place question marks near/in lines you do not understand –Write a question in the 2 nd column
8.5 Translation Eukaryotes also control gene expression by location In multicellular organisms, different cells must be told when to express genes at different times/locations. –Catch: every cell has the same genes in a body… –solution: transcription factors.
8.5 Translation Fig Available signals (b) Lens cell Crystallin gene expressed Available signals LENS CELL NUCLEUS LIVER CELL NUCLEUS (a) Liver cell Crystallin gene not expressed Albumin gene expressed Albumin gene not expressed Signals can specify gene expression changes in cell
8.5 Translation Transcription begins the process of gene expression. Coding information in a gene is stored on the sense strand Transcription copies DNA using a strand as a template –Anti-sense (non-coding) strand
8.5 Translation Transcription practice Transcribe the following DNA sequence: TTAGGCACGTAGGAATTTTTTGATAG
8.5 Translation Reverse-transcribe this RNA sequence into DNA: UUAGGGCAGUUAGCAUUACUAUAUUUCCC
8.5 Translation
Updates: Homework: –Shopping: buy highlighters (2 colors) –8.5 DRTA due tomorrow –Genes questions due tomorrow Quizzes continue tomorrow: 8.4 Midterm: Pd 2-3 Tues 1/19, 6-7, 7-8 Wed 1/20 AAP: Tuesday and Thursday
8.5 Translation LEQ: How is genetic information transcribed? Activator: Predict the nucleotide sequence of the complementary RNA transcript DNA: CATAAACCCTG RNA: ? –Reverse-transcribe the RNA sequence RNA: UUAGGCCGGAUU DNA: –Finish page 2 of transcription questions
8.5 Translation RNA polymerase catalyzes RNA synthesis (making RNA). Initiation: RNA polymerase binds to promoter –DNA unwound…
8.5 Translation Elongation: The enzyme bonds RNA bases together
8.5 Translation Termination: transcript released –DNA bases pair together
8.5 Translation Review: At your seat: page 3 transcription initiation complex read –Highlight only –Answer questions –Pair-share when finished
8.5 Translation
Transcription makes different types of RNA from different types of genes. Messenger RNA (mRNA) is translated to make a protein
8.5 Translation mRNA transcripts are edited before translation: –Intron removal, cap/tail addition –Correct coding information can be read! RNA processing changes transcripts in eukaryotes
8.5 Translation Alternative splicing can produce many versions of mRNA
8.5 Translation Summary: Explain the relationship between a codon and an amino acid. Which amino acid would be encoded by the mRNA codon CGA? Reverse transcribe the following RNA codon into DNA: –UAG
8.5 Translation Transcription & Translation Practice 4) Transcribe the following DNA: GTT CGG TTG GCA 5) Translate the following codons: –UUU UAC AAA AGA GCG UGA 6) Transcribe and translate: GAA GCT ATG AAA CGA TAT GGG CTG 7) Create a transcript for: val arg leu ala glu ala met
8.5 Translation
Non-coding genes are processed to make rRNA, tRNA
8.5 Translation Proteins are made from “essential” amino acids and rxns. Monomer: amino acid –Common structure, unique “R” groups –below: general amino acid structure
8.5 Translation R-groups: the chemical identities of amino acids GlycineAlanine
8.5 Translation Polypeptides consist amino acids linked by peptide bonds
8.5 Translation Polypeptides differ in number and order of amino acids. characteristic sequence of every macromolecule changes in sequence alter structure/function
8.5 Translation
Folds from H-bonds enable structure to function changes in amino acids alter structure/function