Is behavior caused by genes or environment?
Can the environment influence the function of genes?
Gene sequence is inherited (you’re stuck with what you have) However: Gene expression is influenced by inheritance AND age, tissue type, physical environment and social environment atgtcagccgataactgactgatcgtaaattgagtttt protein messenger RNA (mRNA) “gene expression” = mRNA abundance gene
Variation in gene sequence (DNA polymorphisms) can be found by “gene mapping” and DNA sequencing Variation in gene expression can be found using “microarrays” atgtcagccgataactgactgat c gtaaattgagtttt protein messenger RNA (mRNA) “gene expression” = mRNA abundance gene atgtcagccgataactgactgat g gtaaattgagtttt DNA polymorphism Microarrays measure mRNA abundance for 1000s of genes simultaneously
Behavioral division of labor in the honey bee colony
% old foragers in colony % introduced bees that initiated foraging by day 14 Age at onset of foraging is socially regulated
Behavioral division of labor in the honey bee colony Age at onset of foraging is socially regulated Inhibitory social pheromone Nurse Forager
Behavioral division of labor in the honey bee colony Age at onset of foraging is also genetically variable mlc m mlc c mlc l Introduced bees Host colony % of introduced bees foraging at 15 days of age m, c and l are different genetic strains
Each pair of spots is a “detector” for mRNA abundance for 1 bee gene. We can analyze mRNA abundance for ~5500 different genes at the same time (in a single dissected bee brain) Honey bee brain microarray
Comparing gene expression in a nurse brain vs. a forager brain Nurse mRNA level Forager mRNA level Dissected nurse brain microarray hybridization Dissected forager brain labeling reaction
Do age-related changes in behavior involve changes in gene expression in the brain? ~700 one-day- old bees (marked) “Typical” host colonies (ca. 40,000 mixed-age bees) Collect marked bees day 7day 30 Young nurses (n = 18) Old foragers (n = 18)
YNOF Genes Bee brains Yellow = high mRNA abundance Blue = low mRNA abundance YN = young nurse OF = old forager About 1/3 of genes expressed in the bee brain show differences in expression! But… Are gene expression differences really associated with behavior differences or with age?
YNOF Genes Bee brains Yellow = high mRNA abundance Blue = low mRNA abundance YN = young nurse OF = old forager About 1/3 of genes expressed in the bee brain show differences in expression!
Changing age-demography in the colony (i.e., social environment) allows us to collect “precocious” young forgers and “over-aged” old nurses ~1500 one-day-old bees (marked) All bees are same age!!! Collect marked bees day 7day 30 Young nurses (n = 6) Old nurses (n = 6) Young foragers (n = 6) Old foragers (n = 6)
YNOF YN ONYF OF Genes Bee brains Yellow = high mRNA abundance Blue = low mRNA abundance YN = young nurse YF = young forager ON = old nurse OF = old forager Gene expression was primarily associated with behavior, not age!
YNOF YN ONYF OF Genes Bee brains Yellow = high mRNA abundance Blue = low mRNA abundance YN = young nurse YF = young forager ON = old nurse OF = old forager
> <0.5 Although 1/3 genes show differences, only ~50 genes are needed to “predict” whether a bee is a nurse or a forager (Whitfield, Cziko & Robinson. Science 2003, 302: 296) Y = young (7 ±2 days) O = old (30 ±2 days) N = Nurse F = Forager Typical colony bees Single-cohort (age-matched) bees mRNA level
Is gene expression in the brain a cause or consequence of behavior? Brain gene expression Upstream regulation of behavior Behavior Brain gene expression Consequence of behavioral activity, experience or environmental differences ? ? Behavior -- or --
Is gene expression in the brain a cause or consequence of behavior? Manipulate gene expression in brain Effects on behavior? Direct test of causation:
Is gene expression in the brain a cause or consequence of behavior? Direct test of causation: Manipulate gene expression in brain Effects on behavior? Can’t do this yet – need transgenics!!!
Is gene expression in the brain a cause or consequence of behavior? Brain gene expression Upstream regulation of behavior Behavior Brain gene expression Consequence of behavioral activity, experience or environmental differences ? ? Behavior -- or --
Brain gene expression in the absence of task-related experience Caged bees (no task-related experiences)
Brain gene expression in the absence of task-related experience Social cue or treatment that accelerates the onset of foraging Forager-like changes in brain gene expression? Caged bees (no task-related experiences)
Brain gene expression in the absence of task-related experience Social cue or treatment that accelerates the onset of foraging Social cue or treatment that delays the onset of foraging Forager-like changes in brain gene expression? Nurse-like changes in brain gene expression? Caged bees (no task-related experiences)
High in foragers (32) High in nurses (18) Induced by methoprene (249) 130 Repressed by methoprene (222) 011 Treat with methoprene (JH analog) Caged bees (no task-related experiences) Juvenile hormone analog (methoprene) accelerates the onset of foraging and causes forager-like changes in brain gene expression (in the absence of experience) “marker” genes Whitfield CW et al. PNAS Oct 31; 103(44):
Caged bees (no task-related experiences) Treat with QMP High in foragers (32) High in nurses (18) Induced by QMP (602) 04 Repressed by QMP (704) 182 Queen mandibular pheromone (QMP) delays the onset of foraging and causes nurse-like changes in brain gene expression (in the absence of experience) “marker” genes Grozinger CM, Sharabash NM, Whitfield CW, Robinson GE. PNAS Nov 25; 100:14519
Is behavior caused by genes or environment? Can the environment influence the function of genes?
Nurse Comb-builder Guard Undertaker (corpse-remover) Forager Many behaviors… but how many involve gene expression differences? > < 0.5 Gene clusters (expression level in brain)
Are gene expression changes robust at the level of individual? Can gene expression profile in an individual bee’s brain be used to correctly predict behavioral group?
Method: 1.Computer identifies a set of “predictor genes” for behavior using expression data from the 59 bees in the “training set.” 2.Computer attempts to classify the single “test” bee based on its expression of the predictor genes. 3.Repeat iteratively for all 60 individual bees. Result: Computer can correctly assign behavior group for 57 out of the 60 bees. “Training set” 59 bees (computer knows behavior) 1 bee (computer attempts to classify) “Leave-one-out” cross-validated class prediction “Test set” nurse or forager?