DNA sequencing

Maxam-Gilbert’s chemical degradation DNA sequencing (in 1977)

DNA sequencing Sanger sequencing in 1977 Dideoxynucleotide synthetic method DNA sequencing reactions are very similar to the PCR reactions for replicating DNA (Denaturation, Annealing and Replication).  The reaction mix includes : template DNA free nucleotides enzyme (usually Taq polymerase) primer - a small piece of single-stranded DNA (20-30 nt long) Difference between DNA sequencing reaction and PCR reaction?

Dideoxynucleotides: nucleotide, which has has no 3' hydroxyl group Once the dideoxynucleotide was added to a DNA strand, elongation step of DNA is no longer possible due to the absence of hydroxyl group at 3’ end. This results the termination of DNA elongation step. 3’ GATCGATTGGCCATGTAAAGGCTGTATGCAGCCTTTAAGGTGCCAAAGGT 5 ’ CTAGCTAACCGGTACATTTC 5’ CTAGCTAACCGGTACATTTC

Usually G is yellow color labeled.

An automated sequencing In a large-scale sequencing lab, automated sequencing system is the combination of an electrophoresis step and a monitor system of the different colors as they come out. Automated DNA sequences: Electrophoresis system: 'capillary electrophoresis’ Monitoring system: sequencing product comes out to the far end in size-order (the shorter product the earlier passing through) and an ultraviolet laser built into the machine that shoots through the liquid emerging from the end of the capillaries, checking for pulses of fluorescent colors to emerge.

NGS-Next Generation Sequencing TED: Richard Resnick shows how cheap and fast genome sequencing is about to turn health care (and insurance, and politics) upside down. The Human Genome Project(HGP) Initiated in 1990 by the U.S. Department of Energy(DOE) and completed on April 14, 2003, with the goal of determining the complete sequence of the human genome Involved 3,000 scientists working at 20 centers in 6 countries The estimated budget: $3 billion NGS Capable of sequencing > 1 billion bp per reaction 200x faster than the Sanger approach At a low cost with “High-throughput”

NGS ABIRocheIluminaLifeTech/ThermoPacbio

DNAnexus Enables Seamless Assembly of PacBio Data for J. Craig Venter Genome Cloud Platform Facilitates and Speeds Reference Quality De Novo Whole Genome Sequencing March 02, :00 AM Eastern Standard Time MOUNTAIN VIEW, Calif.--(BUSINESS WIRE)--DNAnexus Inc., a pioneer in cloud-based genome informatics and data management, today announced that it now offers whole genome assembly using long read sequencing data generated by the PacBio RS II. To demonstrate the new capability, DNAnexus and PacBio researchers used Daligner written by Gene Myers and PacBio’s FALCON genome assembler to perform de novogenome assembly of the complete genome of J. Craig Venter, a pioneer in genome sequencing, on the DNAnexus cloud platform.BUSINESS WIREJ. Craig Venter De novo genome assembly is a data and compute intensive task. Researchers performing de novo processing often find that their local infrastructure does not have the available resources or expertise necessary for the complex assemblies. The DNAnexus platform gives scientists access to massive computational resources on a cost-effective, on-demand basis and has packaged the FALCON assembler in a way that can be run without complicated installation. “It is essential to have full and accurate de novo human genome assemblies to facilitate our understanding of disease, and it’s terrific that the DNAnexus platform allows researchers to leverage PacBio tools and massive datasets to conduct these types of pioneering research projects in the cloud.”

Bacterial transformation

Preparation of Chemically Competent Cells Materials E. coli cells (Rosetta) LB media 0.1M CaCl2 solution (ice cold) Chilled 50-ml polypropylene tubes 1M CaCl2 solution (10X stock solution) g of calcium chloride (SIGMA) - Bring the total volume up to 1L with water - Filter sterilize - Store at 4°C

Rosetta, BL21(DE3) E. coli strain: Genotype: F - ompT hsdS B (r B - m B - ) gal dcm (DE3) Enhance the expression of eukaryotic proteins that contain codons rarely used in E. coli. These strains supply tRNA genes for AGG/AGA (Arg), AUA (Ile), CUA (Leu), CCC (Pro) and GGA (Gly) on a ColE1 compatible chloramphenicol-resistant plasmid. Thus the Rosetta strains provide for "universal" translation which is otherwise limited by the codon usage of E. coli. As RecA positive, this is not a good host for cloning and should only be used to expression. It also gives lower quality DNA preps, and thus should only be used for plasmid preps when all other alternatives have failed.

Ptac The tac promoter/operator (PTAC): Expression of Ptac is repressed by the LacI protein. The lacI^q allele is a promoter mutation that increases the intracellular concentration of LacI repressor, resulting in strong repression of PTAC. Addition of the inducer IPTG inactivates the IacI repressor

1. Seed culture - Inoculate 50 ul stock of E. coli cells (usually, E. coli stock stored at - 80°C deep freezer and thaw the vial on ice) into 5 ml LB medium. Shake overnight at 200 rpm, 37°C. (Using shaking Incubator) 2. Main culture – Inoculate 250 ul of a seed culture into 25 ml LB medium. Shake 1 hour to 1hour 30 min at 200 rpm, 37°C (Until O.D600 value 0.3~0.4). 3. Transfer the main culture in Chilled 50-ml polypropylene tubes and then on ice, for 15~30 min. 4. Centrifuge for 10 min at 4,000 rpm, 4 °C (Using the high centrifuge). 5. Discard the supernatant, Add 15~17.5 ml of pre-chilled 0.1M CaCl2 solution and then stay on ice, for 15~30 min. 6. Centrifuge for 10 min at 4000 rpm, 4 °C (Using the high centrifuge). 7. Discard the supernatant (Observe your pellets like donut or hollowed arrow shapes), Add 2~5ml of pre-chilled 0.1M CaCl2 solution and then stay on ice (Ready to use after 15~30 min). 8. Use for transformation.

Bacterial growth curve

Transformation of circular DNA of E. coli 1.Prepare the competent cells on ice. 2. Mix 1 ul to 2 ul of the circular DNA (like plasmid) with 200 ul of competent cells. 3. Incubate on ice for 5 to 10 min. 4. Fulfill the Heat shock for 1 min 30 sec at 42°C. (Using the water bath) 5. Incubate on ice for 2 to 5 min. 6. Spread on a LB plate (with selected antibiotics).