Weizmann Institute of Science Transcriptome rewiring in hybrids and polyploids What hybrids can teach us on biodiversity Or

How species are formed? Progenitor Species 1 Hybrid Polyploid Isolation Accumulation of mutations & Natural selection Hybridization Genome doubling Homoploid Dead end Species 2 Genetic barrier Introgression *

Features of Hybrids: Embryonic lethality Adult inferiority Hybrid necrosis Sterility (chromosome pairing or nuclear-cytoplasmic interactions) Heterotic features Broader range of adaptation Novel traits The benefits The troubles

Hybrid (homoploid) species

Allopolyploid species AA X BB (2x) AB AABB (4x)

Ae. sharonensis (genome S l S l ) T. monococcum (genome A m A m ) Amphiploid (S l S l A m A m ) Collaboration with Naama Barkai’s lab Merging of wheat genomes Studying interspecific hybrids and allopolyploids in Two model systems Merging of yeast genomes (sensu stricto, n=16) + F1 P1P2 S. cerevisiae S. Paradoxux

Today’s question: What goes on at the molecular level during speciation/hybridization/ polyploidization ? What drives divergence in gene expression and how is gene expression rewired in hybrids/polyploids

Sensu Stricto (5-20 Mya) The yeast system + F1 P1P2 S. cerevisiae S. Paradoxux

S. cerevisiae hybrid S. paradoxus Max slope Growth vigor in the cerevisiae x paradoxus hybrid How is gene expression rewired ? Are new patterns of expression related to heterosis?

Progenitor Species 1 Hybrid Polyploid Isolation Accumulation of mutations Cis or trans? Hybridization Genome doubling Homoploid Dead end Species 2 Genetic barrier Novel patterns of gene expression merging GENE EXPRESSION EVOLUTION AND REWIRING IN HYBRIDS AND ALLOPOLYPLOIDS

Progenitor cerevisiae paradoxus Hybrid Only Cis divergence SpeciationHybridization c p chch phph c/p = c h /p h Allelic differences are maintained in the hybrid cis=c h -p h c-p= cis+trans

Progenitor cerevisiae paradoxus Hybrid Only trans divergence SpeciationHybridization c p chch phph Allelic differences are abolished in the hybrid c h = p h c > p

Two-species array TGCTCGTCGGGTAGCTAATAGCTAGTGAGATAGGTCCAGCACCATGTCACG TGCCCGTCGTGTAGCTACTGCGTAGAGATGTACGTGCAGTACCATCTCACG *** ***** ******* * *** ** ** ** *** ***** ***** S. cerevisiae S. paradoxus Select 12 homoeoallele-specific 60mers oligos for 4400 genes Analyze allele expression in parental versus hybrid background Tirosh et al Science

PHP-H Cis Only Trans Only Cis+Trans Tirosh et al Science

Alterations in cis factors are the prominent cause of divergence in gene expression Responsiveness to the environment is determined essentially by alterations in trans factors Genome-wide analysis of cis-trans effects

Divergence in gene expression, related to trans effects, is not related to divergence in transcription factors or chromatin remodeler (expression or seq.) but rather to environment signalers What is the origin of the Trans effect?

Same-direction mutationsOpposite direction mutations Genes with both Cis and trans effects-- Impact on over/under expression Prominence of genes with both cis and trans effects among overexpressed and underexpressed genes EnhancingCompensating

Two types of over/under expression in the hybrid: -One type, affecting only one allele, mostly due to novel cis- trans interactions -One type affecting both alleles

Novel expression patterns can be achieved “overnight” in hybrids through novel cis/trans, or trans interactions Compensatory mutations and Hybrid- specific trans effect explain overexpression in hybrids In the hybrid (under rich medium) respiration genes are preferentially overexpressed, maybe causing heterosis.

Thanks to: Cathy Melamed- Bessudo Naomi Avivi- Ragolsky Naama Barkai Itay Tirosh Naama Barkai Sharon Reikhav Dena Leshkowitz

PP AA BB DD BBAA BBAADD Divergence from a common progenitor 2n=2x=14 (~4 MYA) Formation of wild allotetraploid wheat 2n=4x=28 (~0.5 MYA) Domestication of allotetraploid wheat 2n=4x=28 (~10,500 Cal BP) Formation of bread wheat 2n=6x=42 (~9,500 Cal BP) Evolutionary history of wheat

TQ113 TTR16 F1 S1 Heterosis and Hybrid necrosis Aegilops tauschii F1 S1 Triticum durum DDBBAABBAADDBAD

Novel genetic and epigenetic variation released upon hybridization and polyploidization Gene silencing/activation Changes in DNA methylation Transposons activation DNA elimination The small RNAs hypothesis-- A mechanism related to all of the above

Deep sequencing of small RNA w/Illumina/Solexa system: -- Isolation of small RNAs --Amplification --Quality control (trimming “primers” from all tags, NNs, junk..) --Bioinformatic analysis (alignment, annotation, normalization..) TCGCTTGGTGCAGATCGGGACTCGTATGCCGTC TGACAGAAGAGAGTGAGCACTCGTATGCCGTCT GGCGGATGTAGCCAAGTGGATCGTATGCCGTCT GGGCCTGTAGCTCAGAGGATCGTATGCCGTCTT TTGACAGAAGAGAGTGAGCACTCGTATGCCGTC TGAGAAGGTAGATCATAATAGCTCGTATGCCGT GCGTCTGTAGTCCAACGGTTCGTATGCCGTCTT #reads Signatures MiR168

Analysis of small RNA data Annotation: Hits in Micro-RNAs siRNAs corresponding to repeats, transposons Genes, tRNAs rRNA..

Transposons make up about 80% of the wheat genome and therefore present a major hazard to genome stability Adapted from Kronmiller and Wise, Plant Physiol. Vol. 146(1): 45-59, 2008

85% of small RNAs corresponding to transposons are down-regulated in the polyploid ~MPV<MPV>MPV hybrid polyploid 39% 85% 42% 12% 19% 3% n=1113 percent (cumulative) Log 2 (# reads / # reads in MPV) 1

Wis2-1A retrotransposon activation correlates with down-regulation of siRNAs TTR16 TQ113 MPV F1 S Total small RNA count for Wis2-1A: Northern (Wis probe) Kashkush et al. Nat Genet 2003 Keinan-Eichler et al. Unpublished Down-regulation of Wis2-1 siRNAs in S1 Transcriptional activation of Wis2-1 in S1

Small RNAs are highly responsive to Polyploidization They can be induced -- miRNAs or Repressed --siRNAs The suppression of siRNAs correlates with transposons activation

Extensive genetic and epigenetic rewiring occurs in hybrid and polyploids through novel cis-trans interactions that alter the activity of genes, repeats and small RNAs. Phenotypic consequences range from heterotic effects to genetic incompatibilities. Release of transposon silencing might lead to hybrid dysgenesis

Thanks to: Cathy Melamed- Bessudo Naomi Avivi- Ragolsky Naama Barkai Itay Tirosh Naama Barkai Sharon Reikhav Dena Leshkowitz