What is DNA? What does it do?

DNA The Genetic Material Chapter 12: DNA

 Bodies are made up of cells  All cells run on a set of instructions spelled out in DNA Bodies  Cells  DNA 3

Role of DNA DNA is in EVERY living thing  Store information  Copy information  Transmit information 4

DNA  DNA stands for D: Deoxyribose N: Nucleic A: Acid DNA monomer is a nucleotide 5

Structure of DNA: nucleotides  There are 4 different nucleotides found in DNA 1. Adenine (A) 2. Guanine (T) 3. Cytosine (C) 4. Thymine (G) 6

Structure of DNA: nucleotides  The monomers of DNA are nucleotides  Sugar  deoxyribose  Phosphate group  Nitrogen Base  A, T, C, G 7

Structure of DNA: Paired bases  Bases match together  A pairs with T  A : T  C pairs with G  C : G  hydrogen bonds between bases join 2 strands  can separate easily 8

DNA Double Helix  Sugar-phosphate backbone (rails of ladder)  Nitrogenous bases in middle (rungs of ladder)  Create double helix (spiral) 9

Anti-parallel strands  Phosphate to sugar bond involves carbons in 3’ & 5’ positions 10

Closure  What are the monomers of DNA called?  What are the 3 parts that make up DNA?  What are the 4 monomers called? How are they paired?  What is the structure of DNA shaped like? 11

Intro  What are the monomers of DNA called?  What are the 3 parts that make up DNA?  What are the 4 bases called? How are they paired?  What is the structure of DNA shaped like? 12

Making new DNA  Copying DNA  replication  DNA starts as a double-stranded molecule  matching bases (A:T, C:G)  then it unzips… 13

DNA replication  Strands “unzip” at the weak bonds between bases  Enzyme = Helicase Helicase 14

DNA replication DNA polymerase  Enzyme  DNA polymerase  adds new bases DNA bases in nucleus 15

DNA Polymerase Copying DNA  Build daughter DNA strand  use original parent strand as “template”  add new matching bases  Enzymes = DNA polymerase 16

New copies of DNA  Get 2 exact copies of DNA to split between new cells  1 old strand and 1 new strand on each DNA polymerase DNA polymerase 17

Okazaki fragments 18 DNA Ligase seals fragments together on lagging strand

Editing & proofreading DNA  At 1000 bases/second lots of typos  Nucleases excise mismatched bases  reduce error rate from 1 in 10,000 to 1 in 100 million bases 19

 What happens 1 st in replication? Enzyme?  What happens next? Enzyme?  Which way do bases get added? 20

 How does DNA code for cells & bodies?  how are cells and bodies made from the instructions in DNA DNA  Cells  Bodies 21

 DNA has the information to build proteins DNA  Proteins  Cells  Bodies proteins cells bodies DNA gets all the glory, Proteins do all the work 22

nucleus  DNA  DNA is in the nucleus  Proteins  made by a ribosomes in cytoplasm  Need to get gene (DNA) information from nucleus to cytoplasm  mRNA makes a copy of DNA 23

cytoplasm nucleus build proteins DNA RNA messenger RNA (mRNA) takes information from the nucleus to the ribosome mRNA 24

mRNA From gene to protein DNA transcription nucleuscytoplasm a a a a a a a a a aa protein translation ribosome trait 25

DNA vs. RNA DNA  deoxyribose sugar  nitrogen bases  G, C, A, T  T = thymine  T : A  C : G  double stranded RNA  ribose sugar  nitrogen bases  G, C, A, U  U = uracil  U : A  C : G  single stranded 26

Transcription  Making mRNA from DNA  DNA strand is the template (pattern)  match bases  U : A  G : C  Enzyme  RNA polymerase 27

Matching bases of DNA & RNA  RNA polymerase unzips Double stranded DNA AGGGGGGTTACACTTTTTCCCCAA 28

Matching bases of DNA & RNA  RNA polymerase matches RNA bases to DNA bases on one of the DNA strands U AGGGGGGTTACACTTTTTCCCCAA U U U U U G G A A A CC RNA polymerase C C C C C G G G G A A A A A 29

Matching bases of DNA & RNA  U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA 30

At the End  Original DNA strands wind back together  New mRNA strand leaves the nucleus 31

 How are DNA and RNA different?  What kind of RNA is used in transcription?  What is the enzyme used in transcription?  Where does it go? 32

a a a aaa a mRNA From gene to protein DNA transcription nucleus cytoplasm protein translation trait UCCCCCCAAUGUGAAAAAGGGGUU ribosome 33

RNA to protein  mRNA leaves nucleus  mRNA goes to ribosomes in cytoplasm  Proteins built from instructions on mRNA aa mRNA UCCCCCCAAUGUGAAAAAGGGGUU 34

AUGCGUGUAAAUGCAUGCGCC mRNA mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC Met Arg Val Asn Ala Cys Ala protein ?  Codon is a block of 3 nucleotides codons ribosome 35

 several codons for each amino acid  mutation insurance!  Start codon  AUG  methionine  Stop codons  UGA, UAA, UAG The mRNA code 36

Codon on the mRNA Anti-codon on the tRNA TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA amino acid tRNA anti-codon codon UAC Met GCA Arg CAU Val 37

ribosome mRNA to protein = Translation  The reader  ribosome  The transporter  transfer RNA (tRNA) aa tRNA mRNA UCCCCCCAAUGUGAAAAAGGGGUU GGU aa tRNA UAC aa tRNA GA C aa AGU 38

transcription cytoplasm nucleus translation trait 39 DNA RNA Protein

DNA transcription ribosome tRNA amino acids protein translation mRNA 40