Who is smarter? will-your-children-have Chimp speak- Chimp intelligence

DNA

What has DNA? exhibits/genes-common

Where is DNA found? DNA is found inside the cell in the nucleus.

What is a chromosome? A chromosome is a structure in the nucleus that contains the DNA. It is how we keep our DNA organized.

DNA is found in all our cells

Humans have 46 chromosomes There are 23 pairs of chromosomes 23 X 2 = 46 Total There are 23 pairs of chromosomes 23 X 2 = 46 Total

We have 46 chromosomes There are 23 pairs of chromosomes 23 X 2 = 46 Total There are 23 pairs of chromosomes 23 X 2 = 46 Total How many are from mom? How many are from dad? 23

The last pair of chromosomes makes us male or female XXXY

DNA shaped building being made in Taiwan

What does DNA look like? Called a double helix (double twist), sometimes described as a twisted ladder cs.thetech.or g/online- exhibits/zoo ming-dna

Don’t try this at home: If uncoiled, the DNA in all the cells in your body would stretch 10 billion miles—from here to Pluto and back. One single strand is about 2 meters long!!!

Discovery of the structure of DNA This model of DNA was described by James Watson and Francis Crick in 1953 (with the help of many others) and is therefore called the Watson-Crick Model of DNA. (they won a Nobel prize for this. Remember, Rosalind Franklin also played a big role! And Maurice Wilkins !

DNA is made of smaller building blocks These building blocks are called Nucleotides. If DNA was a necklace, the nucleotides would be the beads.

DNA is shaped like a ladder The nucleotides are on the inside of the helix, like rungs of a ladder. The outside of the helix is called the backbone. This is like the sides of a ladder.

DNA made of 4 types of nucleotides (beads) They have different types of bases –T –A –G –C The bases attach (bond) to one another to keep DNA a double helix

Match the corresponding strand of DNA with the correct base: T A C A G C T Two types of bond pairs: A-T G-C Two types of bond pairs: A-T G-C

Match the corresponding strand of DNA with the correct base: T A A T C G A T G C C G T A Two types of bond pairs: A-T G-C Two types of bond pairs: A-T G-C

Mutation: A change in the DNA sequence. Can cause disease or death. T A A G C G A T G C C G T A Two types of bond pairs: A-T G-C Two types of bond pairs: A-T G-C

Human Genome Project: ( ) Scientists determined the sequence (order) of all 6 billion bases (letters) in human DNA. It is like having a manual to the human body. We have about 24,000 genes Has helped identify over 1800 diseases There are now over 2000 tests for genetic diseases

Genetic testing: Genetic Testing: medical test where our DNA is examined to look for genes that can cause genetic disorders. Reasons for testing: Finding genetic diseases in unborn babies Finding out if people carry a gene for a disease and might pass it on to their children Screening embryos for disease Testing for genetic diseases in adults before they cause symptoms Making a diagnosis in a person who has disease symptoms Figuring out the type or dose of a medicine that is best for a certain person

(SMARTnotebook) DO NOW: Arrange from largest to smallest: DNA Chromosome Cell Nucleus Nucleotide Smallest Largest

Genetics Part II

Review: We know DNA is a set of instructions (the blueprint) found in the nucleus. It is useless unless we use the instructions to build things our cell needs!

Where do we find genes? Genes are specific sections on the chromosome that contain instructions.

What are genes? Genes are the special sections of the chromosome that contain the code to make proteins. There are unimportant spaces between genes that don’t make anything! Genes Empt y Space

Gene  Protein The instructions are the order of the nucleotides (A,T,G,C). The letters are a code that the cell can read to figure out what to make. ACGTGCGATTTCAGCTTCGCCAAATCGAATC Hemoglobin (carries oxygen in blood) Keratin (in hair & nails)

Gene  Protein Every one gene contains the instructions to build one protein.

Our 46 chromosomes contain thousands of genes that are used to make thousands of different proteins! Protein Review: They are made up of smaller building blocks called amino acids. Used to make hormones and enzymes. Proteins can also be used to build and repair body parts. We get protein in our diet from meats, beans, fish, nuts, etc.

How exactly are the instructions used? The order of the nucleotides (A,T,G,C) tells the cell what amino acids to string together to make the protein. There are 20 different amino acids that are used to make the different proteins in our body.

After proteins are made, they are folded into different shapes, and this allows them to do different things. Keratin – folds into fibers to leep hair & nails strong Keratin – folds into fibers to leep hair & nails strong Hemoglobin – folds into a nest that allows oxygen to sit in the middle. Hemoglobin – folds into a nest that allows oxygen to sit in the middle.

Structure  Function How a protein is built (its shape and structure) determines what jobs it can do for the cell (its function). Example: Zipper Structure: Function:

What organelle makes proteins? The ribosome (the little dots in the cell) The ribosome (the little dots in the cell)

Why do we look like our parents? 23 chromosomes from mom, 23 chromosomes from dad Chromosomes contain genes which code for proteins We are making a combination of proteins that our mom & dad have! –for hair and eye color –for height and weight –that make dimples, freckles, etc.

What makes our cells different? All our cells contain a nucleus with the same DNA (46 chromosomes, 23 from mom and 23 from dad).

What makes our cells different? Only certain instructions (genes) are used in each cell! Blood cells- use the genes with the instructions needed to make hemoglobin to carry oxygen in our blood Nerve cells- use the genes needed to make proteins that transfer information in our nervous system Heart cells- use genes that create proteins to make our heart beat

Gene control We can control genes by turning them on or off. Different genes are switched “on” in our different cells. Keratin Melanin Keratin- makes hair into strong, long strands Melanin- Gives our hair color. (the more you have, the darker your hair will be!) Turned on genes= they make proteins

Gene control Is called Gene Expression If a gene is turned on it is being “expressed.” The genes are showing themselves, just like we do when we express ourselves. ExpressedNot Expressed

The Environment influences our Genes Childhood nutrition- affects adult height Temperature changes- effect coat color in Himalayan rabbits Light intensity – chlorophyll production in plants. Plants grown in low light are pale Expression of cancer genes influenced by lifestyle choices – smoking, drinking.

Bad effects of the environment The environment can mutate (change) our DNA. –X-rays –Nuclear Radiation –Solar radiation (the sun!) –Chemicals (toxins)

These mutations can cause Cancer! 

Cancer Mutations occur in important places in our DNA(this breaks our genes) ! –Bad genes = cells cant control themselves Cancer cells keep reproducing, and form a tumor

Tumor= ball of cells The tumor cells steal nutrients from the healthy cells, and it takes up important space. If it is cancerous, it can spread & take over our body. Benign tumor- Not cancerous, doesn’t spread to other parts of the body. Malignant tumor (BAD!)- cancerous, can spread to other parts of body