Bell Ringer 3.24 1.Where does translation occur in the cell? 2.Why do we need RNA to make proteins? 3.How can different codons code for the same amino.

Slides:

Advertisements

Similar presentations

DNA, RNA, and Proteins By Liz LaRosa

Advertisements

Gene Mutations. Target #17- I can describe a gene mutation Gene mutation: a permanent heritable change in the sequence of bases in DNA – Effect can cause.

Chapter 12: DNA: The Molecule of Heredity

DNA and Protein Synthesis DNA contains the genetic information to make amino acids Amino acids combine to make proteins These proteins determine the physical.

Protein Synthesis.  Identify the structure and function of DNA, RNA, and proteins.  Recognize diagrams of DNA and RNA, sugars, phosphate groups, nitrogenous.

1.Using the table on Pg. 292, write the amino acid sequence that would be made according to the codons on the mRNA chain. 2.Why do you think this exact.

Mutations (12.4) State Standard

To demonstrate understanding, after this lesson, you should be able to  define mutations  explain how mutations occur when – DNA Replication or Meiosis.

3.4/7.2 DNA REPLICATION Two DNA molecules are constructed from one, therefore each new molecule contains one original strand and one new strand  a semi-conservative.

MUTATIONS Mutations can occur in DNA replication Protein Synthesis.

MON 4/29 wk-6 OBJECTIVE: 9-10 TOPIC: gene mutations DO NOW :  daily grade: READ-APP/Qs AGENDA: WRAP UP :  DW: PRE-LABDUE: TUES  -WK#5 OBJECTIVE.

DNA to Proteins. Unraveling DNA *The structure of DNA allows it to hold information *The order of the bases is the code that carries the information *A.

Gene Regulations and Mutations

Review: DNA, Transcription & Translation

Gene Mutations Chapter 11.

Genetic Mutations. Mutations Mistakes made in the DNA sequencing They can have a range of effects. They can affect the genetic information that is passed.

What is a mutation? A mutation is any change in genetic material. There are many ways for mutations to occur. Common point mutations are...

Mutations Changes to DNA. What are Mutations? Any change to the DNA Mutations in body (somatic) cells can cause cell death or cancer Those in germ (sex)

Mutations Any change in DNA sequence which is not immediately and properly repaired. If they occur in somatic cells then they are non-inheritable, if in.

  Understand what mutations are  Understand how they occur  Analyze the different types of mutations  Understand how mutations affect amino acid.

Regents Biology Mutations Changes to DNA.

DNA to Protein. Chromosomes are made of tightly packed DNA A gene is a section of the DNA molecule that codes for a particular protein. The order of nitrogen.

DNA Mutations What is a gene mutation? Often times, parts of DNA will have a base (or more) missing, added, or incorrect Can be caused by: errors in.

MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.

Chromosomes and Genes Each chromosome has hundreds or thousands of genes. Each gene codes for a particular protein.

Protein Synthesis.  Identify the structure and function of DNA, RNA, and proteins.  Recognize diagrams of DNA and RNA, sugars, phosphate groups, nitrogenous.

MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.

Gene Regulation and Mutation Notes and Questions How do mutations affect a cell?

From DNA to Protein. Proteins Proteins are complex 3D structures that play a key role in cell function. All controlling enzymes are made out of protein.

GENETIC MUTATIONS What is this picture depicting?.

Mutations – random Replication errors Don’t necessarily lead to harm, but some do Permanent change in sequence – If in gamates (sex cells), passed to offspring.

Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)

Human Genetic Mutations. 2 Main Types of Mutations 1.) Chromosomal Mutations 2.) Gene Mutations.

DNA Mutations. Remember that during DNA replication, the DNA makes an exact copy of itself before it divides. DNA replication is not always accurate.

Mutations and Genetic Disorders. Review One Wrong Letter Questions to think about: 1) How is the little boy in the video.

What is a codon? Above it shows how we read triplets, codons, and amino acids in a READING FRAME. For instance if we looked at the codons out of ‘reading.

MUTATIONS Mutations Defined: a change in an organism’s DNA. Many kinds of mutations can occur, especially during replication. 2 Types: 1)Gene Mutations:

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcriptiontranslation.

Human Genetic Mutations

11.3 Mutations.

Bellringer Three consecutive bases in mRNA are known as what?

Mutations (12.4) State Standard

Translation: From RNA to Proteins

Mermaid Syndrome Video.

Gene Mutations Chapter 11.

The Central Dogma Through the production of mRNA (transcription), and the synthesis of proteins (translation), the information contained in DNA is expressed.

What happens when things go wrong?

Gene Mutations.

Protein Synthesis.

Errors in DNA Mutations.

To be successful today…

4c. Know how mutations in the DNA sequence of a gene may or may not affect the expression of the gene or the sequence of amino acids in the encoded proteins.

Welcome to Genetic Mutations!

Distinguish between codon and anticodon.

DNA and the Genome Key Area 6a & b Mutations.

Mutations Ms MacCormack Fall 2018.

DNA and the Genome Key Area 6a & b Mutations.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Draw a conclusion from this graph for both the red and blue line

Presentation transcript:

Bell Ringer Where does translation occur in the cell? 2.Why do we need RNA to make proteins? 3.How can different codons code for the same amino acid?

Gene Mutations

DNA: ATGGTAGCTAACCTT DNA Comp: mRNA: tRNA: AA:

DNA: CAGGAATTGCTCGAT DNA Comp: mRNA: tRNA: AA:

DNA: GTACTCAAGGTCTAG DNA Comp: mRNA: tRNA: AA:

DNA: TTTCAATCGACCAAC DNA Comp: mRNA: tRNA: AA:

Mutation = a change in the DNA sequence ▫Can change the protein as well A mistake that’s made during replication or transcription Can be: ▫Harmful: diseases or deformities ▫Helpful: organism is better able to survive ▫Neutral: organism is unaffected MOST mutations are NEUTRAL!

1.What does CGC code for? 2.What does CGG code for? 3.What does AGG code for? 4.What does AGA code for? 5.What does CGA code for? Why are so many mutations neutral?

If a mutation occurs in a gamete cell (sex cell), that mutation is passed onto offspring. If a mutation occurs in a body (somatic) cell, that mutation affects only the organism and is not passed onto offspring.

Point Mutations (aka substitution) Bases are mismatched or one base is changed.

The Dog Bit the Cat The Dog Bit the Ca r Both of these are sentences. One works perfectly, the other does not. The point mutation leaves a sentence with words, but it does not make sense.

The change of one amino acid (word) changes how the protein (sentence) works.

Point mutations can be harmful when a mistake results in the wrong amino acid. One single change can affect the entire protein.

Silent (Point) Mutations Not harmful when a mistake is carried into mRNA but still results in the same amino acid.

Frameshift Mutations Bases are inserted (addition) or deleted. Usually harmful because it can result in the coding of many wrong amino acids.

The Dog Bit the Cat Addition: The Dog eBi tth eCa t Deletion: The Do B itt heC at One base pair is deleted or added, and the entire strand “shifts” over The deleted “G” or the inserted “E” alters the entire sequence

Causes of Mutations Mutagen: Anything that causes a change in DNA

Common Mutagens X-rays UV Radiation Nuclear Radiation Asbestos Cigarette Smoke

Cystic Fibrosis (CF) Recessive genetic disorder An individual with CF has thick mucus in the lungs and airways, leading to many lung problems. Why is there a build up of mucus?

Lungs are lined with specialized cells These special cells clear dust and excess mucus

Mutations in the CFTR gene blocks CFTR protein function Changes in the DNA sequence lead to a protein that cannot reach the plasma membrane Healthy CellCystic Fibrosis Cell

Cystic Fibrosis airways are dehydrated and cannot clear mucus Healthy Airway Normal mucus CF Airway Thick, dry mucus

Cystic Fibrosis airways accumulate bacteria and inflammatory cells Pseudomonas aeruginosa Too many inflammatory cells can cause permanent lung-cell damange

Cystic Fibrosis Activity YOU be the Investigator! Complete Part 1 of the Activity

Upon analysis of samples, you now have two patients that may have Cystic Fibrosis. To give either patient an official diagnosis, you must sequence their DNA to see if they have the cftr mutation. Complete Part 2 of the Activity

Current Cystic Fibrosis Treatments 1.Bronchodilators ▫Opens up airways ▫Oral, injectable, or inhalable drugs 2.Airway clearance techniques ▫Removes mucus ▫Coughing and assist devices 3.Antibiotics ▫Treat infections in airways ▫Oral, injectable, or inhalable drugs

Gene Therapy Addition of normal cftr gene to lung cells Delivered by a special virus Goal → replace mutated genes responsible for disease in order to cure the disease (targets the cause, not the symptoms) Cystic Fibrosis CellHealthy Cell

Agenda 3.25… Bell RingerBy the bell you need… 1.How do feel about your performance the 1 st nine weeks? 2.What areas do you feel like you did well in? 3.What areas do you feel like you need to work on? 4.Does your grade match your work ethic? 5.Explain #4. 1.Bell Work/TOTD complete. 2.Mutations Practice 3.Web Quest (Extra credit) 4.Cell Membrane!!!! 5.DNA Paper Model!! 6.Missing work turned in.. 1.Tests/Quizzes 2.Test Corrections 3.Missing classwork/homework 4.Extra credit