CAMPBELL BIOLOGY Reece Urry Cain Wasserman Minorsky Jackson © 2014 Pearson Education, Inc. TENTH EDITION CAMPBELL BIOLOGY Reece Urry Cain Wasserman Minorsky Jackson TENTH EDITION DNA Tools and Biotechnology Lecture Presentation by Nicole Tunbridge and Kathleen Fitzpatrick

© 2014 Pearson Education, Inc. “OMG- all of my bacteria look the same and/or I have no idea what I am finding on my plates…!”  Bacteria are hard to identify!  Theoretically, there are lots of small, white colonies that are coccus and gram positive under the microscope!  So… which one are you finding?  Let the DNA help you!

© 2014 Pearson Education, Inc.  Biotechnology is the manipulation of organisms or their components to make useful products  The applications of DNA technology affect everything from agriculture, to criminal law, to medical research

© 2014 Pearson Education, Inc. DNA sequencing is a valuable tool for genetic engineering and biological inquiry  The complementarity of the two DNA strands is the basis for nucleic acid hybridization, the base pairing of one strand of nucleic acid to the complementary sequence on another strand

© 2014 Pearson Education, Inc. DNA Sequencing  Researchers can exploit the principle of complementary base pairing to determine a gene’s complete nucleotide sequence, called DNA sequencing  The first automated procedure was based on a technique called dideoxy or chain termination sequencing, developed by Sanger

© 2014 Pearson Education, Inc.  “Next-generation sequencing” techniques use a single template strand that is immobilized and amplified to produce an enormous number of identical fragments  Thousands or hundreds of thousands of fragments (400–1,000 nucleotides long) are sequenced in parallel  This is a type of “high-throughput” technology

© 2014 Pearson Education, Inc. Figure 20.4a Technique Genomic DNA is fragmented. Each fragment is isolated with a bead. Using PCR, 10 6 copies of each fragment are made, each attached to the bead by 5′ end. The bead is placed into a well with DNA polymerases and primers. 4 Template strand of DNA Primer 3′3′ A 3′3′ 5′5′ 5′5′ T G C A solution of each of the four nucleotides is added to all wells and then washed off. The entire process is then repeated.

© 2014 Pearson Education, Inc. Figure 20.4b 6 7 If a nucleotide is joined to a growing strand, PP i is released, causing a flash of light that is recorded. If a nucleotide is not complementary to the next template base, no PP i is released, and no flash of light is recorded. Template strand of DNA Primer DNA polymerase dATP dTTP PP i C C C C A A A A T T T G G G G Technique AT G CAT G C A C C C C A A A A T T T G G G G A

© 2014 Pearson Education, Inc. Figure 20.4c 8 Technique AT G C AT G C C C C C A A A A T T T G G G G C C C C A A A A T T T G G G G A A C dGTP dCTP PP i The process is repeated until every fragment has a complete complementary strand. The pattern of flashes reveals the sequence.

© 2014 Pearson Education, Inc. Figure 20.4d Results 4-mer 3-mer 2-mer 1-mer A T G C

© 2014 Pearson Education, Inc. How do we prepare for sequencing? 1.Pick 3 distinct colonies  They should look different  You should know where they came from, and you should have gram stained this colony before. 2.Grow up in liquid culture 3.PCR 4.Run out on gel to confirm PCR 5.Prep for sequencing 6.Sequencing results will be BLASTed

© 2014 Pearson Education, Inc. Amplifying DNA: The Polymerase Chain Reaction (PCR)  The polymerase chain reaction, PCR, can produce many copies of a specific target segment of DNA  A three-step cycle—heating, cooling, and replication—brings about a chain reaction that produces an exponentially growing population of identical DNA molecules  We are amplifying a gene segment that codes for the 16S ribosomal subunit.  Why do you think this is a good target if we are trying to differentiate the type of bacteria seen?

© 2014 Pearson Education, Inc. Example of DNA differences in the 16S Ribosomal subunit of different bacteria DNA DNA change 16S ribosomal gene for S. epidermidis 16S ribosomal gene for E. coli A T C G These genes are VERY similar, except for a few nucleotide differences. Differ based on type of bacteria.

© 2014 Pearson Education, Inc.  The key to PCR is an unusual, heat-stable DNA polymerase  PCR uses a pair of primers specific for the sequence to be amplified  Primers for 16S ribosomal RNA are universal within bacteria- good for us!

© 2014 Pearson Education, Inc. Figure 20.8 Target sequence Genomic DNA Technique Denaturation 5′5′ 5′5′ 5′5′ 5′5′ 3′3′ 3′3′ 3′3′ 3′3′ Annealing Extension Cycle 1 yields 2 molecules Primers New nucleotides Cycle 2 yields 4 molecules Cycle 3 yields 8 molecules; 2 molecules (in white boxes) match target sequence

© 2014 Pearson Education, Inc. Figure 20.8a Target sequence Genomic DNA Technique 5′5′ 5′5′ 3′3′ 3′3′

© 2014 Pearson Education, Inc. Figure 20.8b-1 Denaturation Technique 5′5′ 5′5′ 3′3′ 3′3′ Cycle 1 yields 2 molecules 1

© 2014 Pearson Education, Inc. Figure 20.8b Denaturation Technique 5′5′ 5′5′ 3′3′ 3′3′ Cycle 1 yields 2 molecules Annealing Primers

© 2014 Pearson Education, Inc. Figure 20.8b Denaturation Technique 5′5′ 5′5′ 3′3′ 3′3′ Cycle 1 yields 2 molecules Annealing Extension Primers New nucleotides

© 2014 Pearson Education, Inc. Figure 20.8c Technique Cycle 2 yields 4 molecules Cycle 3 yields 8 molecules; 2 molecules (in white boxes) match target sequence Results After 30 more cycles, over 1 billion (10 9 ) molecules match the target sequence.

© 2014 Pearson Education, Inc. Separate DNA fragments  To separate and visualize the fragments produced by PCR, gel electrophoresis would be carried out  This technique uses a gel made of a polymer to separate a mixture of nucleic acids or proteins based on size, charge, or other physical properties  Running our PCR product through the gel helps to confirm you amplified the gene region  If there is nothing in the well, PCR failed  If there is a band shown, PCR worked  The brighter the band, the more DNA is present

© 2014 Pearson Education, Inc. Figure 20.7a Anode Cathode Wells Gel Mixture of DNA mol- ecules of different sizes Power source (a) Negatively charged DNA molecules move toward the positive electrode.

© 2014 Pearson Education, Inc. Figure 20.7b (b) Shorter molecules are slowed down less than longer ones, so they move faster through the gel.

© 2014 Pearson Education, Inc. Send PCR products out for sequencing  We send our samples to Dana Farber in Boston  In roughly 24 hours, we get sent our results online.  Example of a result: NNNNNNNNNNNNNNNNNNNGCAGTCGAGCGGNNAGATGGGAGCTTGCTCCCTGATGTTAGCGGCG GACGGGTGAGTAACACGTGGGTAACCTGCCTGTAAGACTGGGATAACTCCGGGAAACCGGGGCTAA TACCGGATGCTTGTTTGAACCGCATGGTTCAAACATAAAAGGTGGCTTCGGCTACCACTTACAGATG GACCCGCGGCGCATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCAACGATGCGTAGCCGACCT GAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTAGG GAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTTTTCGGATC GTAAAGCTCTGTTGTTAGGGAAGAACAAGTACCGTTCGAATAGGGCGGTACCTTGACGGTACCTAAC CAGAAAGCCACGGCTAACTACNNNNNNNNNNNNNNNNNNNNATANNN

© 2014 Pearson Education, Inc. BLAST database  The results are then entered into a database that all scientists use BLAST: Basic Local Alignment Search Tool  Your results will look similar to this: