1 Chapter 7 DNA Fingerprinting

Forensic Science: Fundamentals & Investigations, Chapter 7 2 Introduction: Except for _____________, no two people on earth have the same DNA (deoxyribonucleic acid). Since the 19____’s, DNA evidence is used to: a) investigate crimes b) establish paternity c) identify victims of war and large-scale disasters. Identical twin DNA

Forensic Science: Fundamentals & Investigations, Chapter 7 3 Introduction: DNA evidence is a form of individual evidence since it can be traced back to one and only one person.

Forensic Science: Fundamentals & Investigations, Chapter 7 4 History of Biological Evidence in Forensics -Types of biological evidence: skin_______salivaurine semen_____ -Biological evidence is examined for the presence of inherited traits like blood type and enzyme variants.

Forensic Science: Fundamentals & Investigations, Chapter 7 5 History of Biological Evidence in Forensics When human cells are present in biological evidence, their chromosomes can be examined to determine whether evidence comes from male or female. The analysis of chromosomes is known as _______________.

Forensic Science: Fundamentals & Investigations, Chapter 7 6 History of Biological Evidence in Forensics Blood-typing techniques were first developed to make transfusions safe. Blood-typing can also be used in __________testing because blood type is an inherited trait.

Forensic Science: Fundamentals & Investigations, Chapter 7 7 History of Biological Evidence in Forensics ________________, also known as DNA profiling, is used in criminal and legal cases to determine ________ or ____________. DNA can be extracted from very small amounts of biological evidence: – Drop of blood – Single hair follicle

Forensic Science: Fundamentals & Investigations, Chapter 7 8 The Function and Structure of DNA DNA: - is the blueprint of life. - contains the genetic information of the cell. - holds all of the information and instructions needed for a cell to make ___________ and to _____________ (make copies of itself). - stores genetic information in structures called ________________.

Forensic Science: Fundamentals & Investigations, Chapter 7 9 The Function and Structure of DNA DNA is made of ____ strands. Because of this, it is called a double helix. The “sides” of the ladder are called the backbone. The backbones consist of alternating ________ and _________ molecules. DNA resembles a twisted ladder. The “rungs” are made of pairs of molecules called nitrogenous bases (bases for short).

Forensic Science: Fundamentals & Investigations, Chapter 7 10 The Different DNA Bases: DNA has 4 Bases: A = Adenine C = Cytosine G = Guanine T = Thymine Each base is bonded to the ________ molecule of the backbone on one side and can form weak hydrogen bonds with one specific base on the other strand of the DNA.

Forensic Science: Fundamentals & Investigations, Chapter 7 11 The base pairing rules are as follows: _________ (A) only bonds with Thymine (T) ________ (C) only bonds with Guanine (G) When the base pairs of two human DNA strands form a double helix, the DNA strands are said to be complementary: Ex: If order of bases in one section is CTGATC, then the order in the complementary section is: __________

Forensic Science: Fundamentals & Investigations, Chapter 7 12 The Different DNA Bases cont… There are __ pairs of chromosomes. A total of ___ in the nucleus of most human body cells. The exception is the sperm and the egg. They only have one of each of the 23 chromosomes. One chromosome in each pair is inherited from the mother and the other chromosome of the pair is inherited from the father. (1/2 of the nuclear genetic information from mom and ½ from dad)

Forensic Science: Fundamentals & Investigations, Chapter 7 13 The Different DNA Bases cont… DNA in the chromosome is called _________and is virtually identical in all cells of the human body.

Forensic Science: Fundamentals & Investigations, Chapter 7 14 The Different DNA Bases cont… Another type of DNA is found in the __________ of the cell. Mitochondrial DNA: – Exists in the form of a circular loop. – Inherited only from the mother.(unlike nuclear) – Passed onto the offspring in the cytoplasm of the egg cell. – None of the mitochondrial DNA comes from the sperm cell.

Forensic Science: Fundamentals & Investigations, Chapter 7 15 Nuclear DNA vs. Mitochondrial DNA:

Forensic Science: Fundamentals & Investigations, Chapter 7 16 Genes and Alleles: Each chromosome contains many ________. Genes: – Are DNA sequences that have __________ that determine our inherited characteristics or traits. Ex: blood type, eye color, hair color… – Can also make another type of nucleic acid called ribonucleic acid (RNA).

Forensic Science: Fundamentals & Investigations, Chapter 7 17 Genes and Alleles: cont… An _______: – Is one of two or more alternative forms of a gene. Ex: normal hemoglobin vs. abnormal hemoglobin – One allele comes from the mother, the other from the father.

Forensic Science: Fundamentals & Investigations, Chapter 7 18 Genes and Alleles cont…: The human genome: – Total amount of DNA in a cell – Contained in chromosomes and mitochondria – Contains approximately 3 million base pairs. Chromosomes contain DNA: -used to make proteins or other molecules called encoded DNA (_______). chromosomes in each cell contain 23,688 encoded genes, with each gene averaging 3,000 base pairs. This is less than 1.5% of DNA in the genome.

Forensic Science: Fundamentals & Investigations, Chapter 7 19 Genes and Alleles cont… Chromosomes also contain DNA that does NOT produce protein or RNA molecules. These are called unencoded DNA (______): 98.5% of DNA in genome is noncoding DNA. Some of noncoding DNA is used in gene regulation and gene splicing. Much of the DNA has no known function called “_______________”.

Forensic Science: Fundamentals & Investigations, Chapter 7 20 DNA Identification Most of the human genome is the same in all humans, but some ________ exists among individuals. This variation: – allows scientists to identify __________. – is found mostly in ___________ DNA. – Is mostly found in the form of repeated base sequences. May be repeated many times. Has different lengths and different sequences of bases in different individuals. Called polymorphisms.

Forensic Science: Fundamentals & Investigations, Chapter 7 21 DNA Identification: DNA fingerprinting or DNA profiling: – A way to isolate and analyze _______________. – Appears as a pattern of _______ on X-ray film – Used to analyze biological evidence. – Because the number and location of polymorphisms are unique in each individual, each band pattern is unique. – Can determine if two or more samples came from the same individual, related individuals, or unrelated individuals.

Forensic Science: Fundamentals & Investigations, Chapter 7 22 Tissue Matching: Notice how some bands are _____ and others are __________. Matching DNA bands have the same width and have traveled the same distance from the well at the top of the gel. Which two lanes have matching band patterns? A B C D E

Forensic Science: Fundamentals & Investigations, Chapter 7 23 Paternity (Inheritance): A child inherits _________for each trait: – One from the mother – One from the father If the two genes from the parents are different, then two bands will appear in the child’s DNA fingerprint. If the two genes from the parents are the same, then only one band would appear in the child’s DNA fingerprint.

Forensic Science: Fundamentals & Investigations, Chapter 7 24 Paternity (Inheritance) Matching: The parents have one daughter and one son together, one daughter is from the mother’s previous marriage, and one son is adopted, sharing no genetic material with either parent. Adopted child? ___ Children between mom and dad? ______________ Child from mother’s previous marriage? ____

Forensic Science: Fundamentals & Investigations, Chapter 7 25 Paternity (Inheritance): Dad? ______ Dad? It’s possible Dad? No

Forensic Science: Fundamentals & Investigations, Chapter 7 26 DNA Identification Scientists focus on two types of repeating DNA sequences in the noncoding sections of DNA: 1) Variable number of tandem repeats (VNTRs) – _________ tandem repeats. 2) _______ tandem repeats (STRs) – short sequence of DNA within the noncoding DNA.

Forensic Science: Fundamentals & Investigations, Chapter )Variable Number of Tandem Repeats (VNTR) Within junk DNA, sequences of DNA are repeated multiple times. The number of copies of the same repeated base sequence in the DNA can vary among individuals. EX: TAGACTACTCTAGACTACTCTAGACTACTC base unit: TAGACTACTC repeated: 3 copies A VNTR can be 9-80 bases in length.

Forensic Science: Fundamentals & Investigations, Chapter ) Short Tandem Repeats (STR) DNA sequences with a high degree of polymorphism are most useful for DNA analysis. Within junk DNA, other sequences of DNA also are repeated multiple times. These usually are only 2-5 bases in length and are becoming the preferred sequences for analysis. Ex: ACTACTACTACT – Base unit: ACT – Repeated: 4 copies

Forensic Science: Fundamentals & Investigations, Chapter 7 29 STR Analysis (a “7, 8”) 7 repeats 8 repeats AATG (Good NIST slides on STRs

Forensic Science: Fundamentals & Investigations, Chapter 7 30 VNTR and STR data are analyzed for: 1) ____________________  Two samples (Ex: crime scene and suspect) that have the same band pattern are from the same individual. 2) ____________________  Matching bands must follow rules of inheritance.  Each band in a child’s DNA fingerprint must be present in at least one parent. DNA Profile:

Forensic Science: Fundamentals & Investigations, Chapter 7 31 Profiler 3 victim

Forensic Science: Fundamentals & Investigations, Chapter 7 32

Forensic Science: Fundamentals & Investigations, Chapter 7 33 Sources of DNA DNA is found in the _________ of cells in the human body. A perpetrator may leave biological evidence at a crime scene. – Ex: blood, semen, saliva, skin, follicular tag This individual evidence is capable of identifying a specific person. But a very small amount of biological evidence might be considered only trace evidence: – It may be consumed during forensic testing. – In 1993, polymerase chain reaction (PCR) technique was invented that generates identical multiple copies of DNA evidence in just a few hours.

Forensic Science: Fundamentals & Investigations, Chapter 7 34 DNA Replication Must take place so that each new cell has its own copy of the genetic code Sequence of events (always occurs from 3’ to 5’ end) –1. hydrogen bonds between bases broken; “unzipping” by an enzyme called helicase –2. free nucleotides in nucleus join with now unbonded nucleotides on DNA structure by DNA polymerase - 3. Ends with two copies of DNA composed of one old and one new strand.

Forensic Science: Fundamentals & Investigations, Chapter ____________. DNA is extracted from cells. - Cells are isolated from biological evidence. DNA can be extracted from the cell,s nucleus. 2. _________________. DNA is cut by restriction enzymes. These enzymes recognize a unique pattern of DNA bases (restriction sites) and will cut the DNA at that specific location. - Different restriction enzymes bind to a specific recognition site. Ex: Hind III recognizes AACGTT Steps of DNA Fingerprinting:

Forensic Science: Fundamentals & Investigations, Chapter 7 36

37 Steps of DNA Fingerprinting: 3. _______________. Specifically chosen DNA fragments are amplified using polymerase chain reaction (PCR).

Forensic Science: Fundamentals & Investigations, Chapter 7 38 Steps of DNA Fingerprinting: 4. ___________________ a) DNA is loaded into the wells found in an agarose gel. b) An electric current is passed through the gel. c) The negatively charged DNA fragments migrate toward the positive end of the gel. d) DNA fragments are separated by size: 1. The smallest DNA fragment moving the fastest through the gel. 2. DNA fragments line up in bands along the length of the gel: shortest fragments forming bands closest to the positive end of the gel, longest fragments forming bands closest to the negatively charged end.

Forensic Science: Fundamentals & Investigations, Chapter 7 39

Forensic Science: Fundamentals & Investigations, Chapter 7 40 DNA and Probes: ____________________ are used to identify the specific unique sequences in a person’s DNA. Different DNA probes are made up of different synthetic sequences of DNA bases complimentary to the DNA strand. It would be impossible to look at all of the DNA restriction fragments produced from an individual’s DNA. There would be so many fragments that the DNA fingerprint would not appear as separate bands, but instead would be a smear of DNA.

Forensic Science: Fundamentals & Investigations, Chapter 7 41 The probe binds to complimentary bases in the strand – Ex: If probe is: TACGTTG then binds to: ATGCAAC – Probe could be labeled with fluorescent dye which _____________________. – Probe could be labeled with a radioactive isotope. X-ray film is then exposed called a autoradiograph. In most criminal cases, 6-8 probes are used. The greater the number, the greater the accuracy of the DNA fingerprint. Both the position and the width of the bands are significant in matching the samples of DNA, and all of the bands have to match exactly.

Forensic Science: Fundamentals & Investigations, Chapter 7 42 Analysis of DNA Fingerprints and Applications In the U.S., the Combined DNA Index System (______) is an electronic database of DNA profiles. It contains DNA profiles of individuals who have been convicted of certain crimes: – Rape, murder, child abuse, etc…… DNA fingerprinting can: a) match crime scene DNA with a suspect b) determine maternity, paternity, or match to another relative c) eliminate a suspect d) free a falsely imprisoned individual e) identify human remains.

Forensic Science: Fundamentals & Investigations, Chapter 7 43 FBIs Combined DNA Index System (CODIS)

Forensic Science: Fundamentals & Investigations, Chapter 7 44