Control VEGF 165 b bevacizumab PC3 cells Saline VEGF 165 b A. B. C.D SalineVEGF 165 b Bevacizumab Vessels/mm -2 ** * Supplementary 1. rhVEGF 165 b administered intraperitoneally slows PC3 tumour growth by inhibiting angiogenesis. A. Tumour growth in nude mice treated with saline, rhVEGF 165 b or Bevacizumab (tumours contours outlined in black). B. Tumour growth curves in the three treatment groups. C. Representative pictures of tumour sections from saline and rhVEGF 165 b -treated mice stained with CD31 to visualize tumour vessels. D. Quantification of micro-vessel density in the three treatment groups (p< 0.001, One-Way Anova). * p<0.05; ** p<0.01.
control SRPK1 KD SRPK1 fold expression (%) Supplementary Figure 2. Quantification of SRPK1 KD in stable PC3 cells transduced with either control or SRPK1 shRNA lendiviral particles by qRT-PCR (A.) and Western blot (B.) 92kDa 45kDaSRPK1 KD CTRL IB: SRPK1 IB: -actin A. B.
Supplementary Figure 3. SRPK1 knockdown triggers a switch in VEGF expression towards the anti-angiogenic isoforms in PC3 as assessed by ELISA for A. Total VEGF and B. VEGF xxx b expression relative to total protein or C. Ratio of VEGF xxx b to VEGF xxx expression. (calculated as VEGF xxx b/(VEGF total -VEGF xxx b) A PAN VEGF PC3 VEGF (pg/µg total protein) B VEGF xxx b PC3 C Excess of anti- angiogenic isoform VEGF xxx b/VEGF xxx PC3 Control KD Control KD Control KD
SRPK1 shRNA CTRL shRNA SRSF6 α - Tubulin SRPK1 α - Tubulin SRSF5 SRSF1/2 SRSF6 (SRp55) SRSF5 (SRp40) SRSF1/2 (ASF/SF2/ SC35) SRSF4 (SRp75) SRSF3 (SRp20) SR (1H4) mab104 A B Supplementary Figure 4. SRPK1 knock–down alters phosphorylation of splice factors in PC-3 cells. Western blot analysis of extracts from control and SRPK1 KD PC3 cells. A. Expression levels of SR proteins are not affected. B. Phosphorylation levels of SRSF1, 2 and 5 are markedly decreased on SRPK1 KD cells.
Neuropilin1: 209bp ladder -RT PC-3 HUVEC Water VEGFR1: 331bp VEGFR2: 220bp Supplementary Figure 5. PC-3 cells express neuropilin 1, VEGFR1 and VEGFR2. RT-PCRs with specific primers on RNA isolated from PC3 cells and HUVECs as positive controls
Supplementary 6. A. SRPK1 transcript quantitation in KD and control tumours as assessed by qRT-PCR. B. Correlation between tumour volumes and SRPK1 transcript number A. Tumour volume (mm^ 3 ) SRPK1 copy no (x10 5 per µg RNA) CTRL SRPK1 KD B. SRPK1 copy no (x10 5 per µg RNA) R= CTRL SRPK1 KD
Supplementary 7. SRPK1 knockdown does not affect VEGF promoter activity. Luciferase driven by VEGF promoter (pGL4 backbone) was transfected in either wild-type, control shRNA or SRPK1 shRNA PC3 cells together with Renilla luciferase plasmid. No effect on VEGF promoter is seen Wildtype shCtl shSRPK1 Luciferase/Renilla
37 25 kDa PC3 Control SRPIN340 10uM SPHINX 10uM SPHINX 7 1uM SPHINXs compound validation using PC3 cell line Supplementary 8. PC3 cell were treated with SRPIN340 and SPHINXs compound for half an hour and protein extracted. The activity of SRPK1 was determined by estimating the expression level of p-SFSR1 via immunoprecipitation (IP) with Mab104 – an anti-phosphoSR antibody, and immunoblotting using SRSF1 antibody (Abcam) IP: mab104 IB:SRSF1
Supplementary Table 1 NRP1 – AACATTCAGGACCTCTCTTGA NRP – AGGACAGAGACTGCAAGTATGAC VEGFR1 - AAATAAGCACACCACGC VEGFR1- ACCTGCTGTTTTCGATGTTTC VEGFR2 - AAAACCTTTTGTTGCTTTTGGA VEGFR2 - GAAATGGGATTGGTAAGGATGA