Cell Division Mitosis

Why do they have to be so small? Why not keep growing – why divide? Surface area to Volume ratio Too much volume, too little space for it to get in Diffusion happens at the same rate, but smaller volume means less dist. to travel.

Surface to Volume Ratio 1 cm 2 to 1 cm 3 4 cm 2 to 8 cm 3 9 cm 2 to 27 cm 3

Diffusion happens at the same rate – it all depends on the distance it has to travel.

Now We Know Why, but what Mitosis is the division of the nucleus Focus is on getting equal and correct chromosomes to each new cell Most multicellular organisms are DIPLOID (2n) – two copies of each chromosome Compared to a haploid cell which only has one copy What type of cell in our bodies are haploid? Diploid? Mitosis is the division of the nucleus Focus is on getting equal and correct chromosomes to each new cell Most multicellular organisms are DIPLOID (2n) – two copies of each chromosome Compared to a haploid cell which only has one copy What type of cell in our bodies are haploid? Diploid?

What does it look like for humans?

Cell Cycle

Nucleus: full of DNA

Ruptured nucleus

Interphase

Prophase

Metaphase

Anaphase

Telophase/cytokinesis

What Controls Cell Division?

What if it won’t stop? Cancer is the uncontrolled growth and reproduction of cells Tumors Benign (non spreading) Malignant (spreading) All depends on access to blood vessels Cancer is the uncontrolled growth and reproduction of cells Tumors Benign (non spreading) Malignant (spreading) All depends on access to blood vessels

Viruses and Cancer

Viruses

When Viruses attack If it goes lytic, then that cell will die And potentially those surrounding it When you deal with prophages (lysogenic) it all depends on when it turns lytic and where the DNA inserts The when often depends on environment The where depends on the DNA If it goes lytic, then that cell will die And potentially those surrounding it When you deal with prophages (lysogenic) it all depends on when it turns lytic and where the DNA inserts The when often depends on environment The where depends on the DNA

DNA – base pairing G pairs with C A pairs with T G pairs with C A pairs with T GACCAGGTCGACCTTATTACGACATGACAGATACCATAGAATGGACAAGG CTGGTCCAGCTGGAATAATGCTGTACTGTCTATGGTATCTTACCTGTTCC

GACCAGGTCGACCTTATTACGACATGACAGATACCATAGAATGGACAAGG Newly inserted viral DNA making a prophage It all Depends on Where If it inserts in non-coding DNA, then no big deal But, if it inserts in the middle of gene, then that gene is no longer functional Then it just depends on what the gene was.

US Mortality, 2001 Source: US Mortality Public Use Data Tape 2001, National Center for Health Statistics, Centers for Disease Control and Prevention, Heart Diseases700, Cancer553, Cerebrovascular diseases163, Chronic lower respiratory diseases123, Accidents (Unintentional injuries)101, Diabetes mellitus71, Influenza and Pneumonia62, Alzheimer ’ s disease53, Nephritis39, Septicemia32, Heart Diseases700, Cancer553, Cerebrovascular diseases163, Chronic lower respiratory diseases123, Accidents (Unintentional injuries)101, Diabetes mellitus71, Influenza and Pneumonia62, Alzheimer ’ s disease53, Nephritis39, Septicemia32, RankCause of Death No. of deaths % of all deaths

Change in the US Death Rates* by Cause, 1950 & 2001 * Age-adjusted to 2000 US standard population. Sources: 1950 Mortality Data - CDC/NCHS, NVSS, Mortality Revised Mortality Data–NVSR-Death Final Data 2001–Volume 52, No Heart Diseases Cerebrovascular Diseases Pneumonia/ Influenza Cancer Rate Per 100,000

Cancer Death Rates*, All Sites Combined, All Races, US, *Age-adjusted to the 2000 US standard population. Source: Surveillance, Epidemiology, and End Results Program, , Division of Cancer Control and Population Sciences, National Cancer Institute, Men Both Sexes Rate Per 100,000 Women

Cancer Death Rates*, for Men, US, *Age-adjusted to the 2000 US standard population. Source: US Mortality Public Use Data Tapes , US Mortality Volumes , National Center for Health Statistics, Centers for Disease Control and Prevention, Lung Colon & rectum Prostate Pancreas Stomach Liver Rate Per 100,000 Leukemia

Tobacco Use in the US, *Age-adjusted to 2000 US standard population. Source: Death rates: US Mortality Public Use Tapes, , US Mortality Volumes, , National Center for Health Statistics, Centers for Disease Control and Prevention, Cigarette consumption: US Department of Agriculture, Per capita cigarette consumption Male lung cancer death rate Female lung cancer death rate

What is Cancer? Cancer is a disease of old age It’s typically a build up of mutations in genes that control the cell cycle We keep seeing more cancer because we live longer Cancer is a disease of old age It’s typically a build up of mutations in genes that control the cell cycle We keep seeing more cancer because we live longer

Metastasis – Cancer with car keys

1.The tumor grows 2.Mutates genes that promote vessel formation (VEGF) – helps it get food 3.Forms a displasia (see left) – begins to invade surrounding tissue 4.Eventually breaks through the blood vessels and spreads

What are some things that play a role in the cell cycle? Cyclin VEGF CDC’s Telomerase p53 Rb p16 ink4a E2F Big T, middle T, small T Ras Myc Jun etc., etc., etc Cyclin VEGF CDC’s Telomerase p53 Rb p16 ink4a E2F Big T, middle T, small T Ras Myc Jun etc., etc., etc

How can we stop it? Some of it you can’t – Why? Mutations happen by accident in ~ 1 in a 1,000,000 replications of DNA We have over 1 Trillion cells – do the math – they’re (mutations) are going to happen Be smart – don’t: smoke, drink excessively, get sun burns, etc Some of it you can’t – Why? Mutations happen by accident in ~ 1 in a 1,000,000 replications of DNA We have over 1 Trillion cells – do the math – they’re (mutations) are going to happen Be smart – don’t: smoke, drink excessively, get sun burns, etc

How do we treat it? Surgery, if possible, to remove the tumor Chemotherapy – Chemical therapy, specifically cytotoxins to go and kill specific cells Radiation treatment – typically a focused high intensity beam of X-rays which both disrupt cell growth but also and mainly cause blood vessels to thicken and eventually close off Surgery, if possible, to remove the tumor Chemotherapy – Chemical therapy, specifically cytotoxins to go and kill specific cells Radiation treatment – typically a focused high intensity beam of X-rays which both disrupt cell growth but also and mainly cause blood vessels to thicken and eventually close off