Center for Bioinformatics and Genomic Systems Engineering Bioinformatics, Computational and Systems Biology Research in Life Science and Agriculture.

Slides:



Advertisements
Similar presentations
Test-tube or keyboard? Computation in the life sciences.
Advertisements

Integrating Genomes D. R. Zerbino, B. Paten, D. Haussler Science 336, 179 (2012) Teacher: Professor Chao, Kun-Mao Speaker: Ho, Bin-Shenq June 4, 2012.
Yan Guo Assistant Professor Department of Cancer Biology Vanderbilt University USA.
Prof. Carolina Ruiz Computer Science Department Bioinformatics and Computational Biology Program WPI WELCOME TO BCB4003/CS4803 BCB503/CS583 BIOLOGICAL.
Bioinformatics and the Engineering Library ASEE 2008 Amy Stout.
August 19, 2002Slide 1 Bioinformatics at Virginia Tech David Bevan (BCHM) Lenwood S. Heath (CS) Ruth Grene (PPWS) Layne Watson (CS) Chris North (CS) Naren.
Bioinformatics at IU - Ketan Mane. Bioinformatics at IU What is Bioinformatics? Bioinformatics is the study of the inherent structure of biological information.
Bioinformatics: One Minute and One Hour at a Time Laurie J. Heyer L.R. King Asst. Professor of Mathematics Davidson College
Jeffery Loo NLM Associate Fellow ’03 – ’05 chemicalinformaticsforlibraries.
Non-coding RNA William Liu CS374: Algorithms in Biology November 23, 2004.
Computer and Information Sciences EDUCATION RESEARCH.
Bioinformatics: a Multidisciplinary Challenge Ron Y. Pinter Dept. of Computer Science Technion March 12, 2003.
Intelligent Systems Group Emmanuel Fernandez Larry Mazlack Ali Minai (coordinator) Carla Purdy William Wee.
What is “Biomedical Informatics”?. Biomedical Informatics Biomedical informatics (BMI) is the interdisciplinary field that studies and pursues.
STAT115 STAT215 BIO512 BIST298 Introduction to Computational Biology and Bioinformatics Spring 2015 Xiaole Shirley Liu Please Fill Out Student Sign In.
Signaling Pathways and Summary June 30, 2005 Signaling lecture Course summary Tomorrow Next Week Friday, 7/8/05 Morning presentation of writing assignments.
CSE 590ST Statistical Methods in Computer Science Instructor: Pedro Domingos.
Bioinformatics Original definition (1979 by Paulien Hogeweg): “application of information technology and computer science to the field of molecular biology”
---- Mark Borodovsky a short intro Position open: Scientist - Pathway Informatics (June 2009) THE POSITION The successful candidate will join the Computational.
CSE 515 Statistical Methods in Computer Science Instructor: Pedro Domingos.
Medical Informatics Basics
Bioinformatics Jan Taylor. A bit about me Biochemistry and Molecular Biology Computer Science, Computational Biology Multivariate statistics Machine learning.
9/30/2004TCSS588A Isabelle Bichindaritz1 Introduction to Bioinformatics.
Bioinformatics Sean Langford, Larry Hale. What is it?  Bioinformatics is a scientific field involving many disciplines that focuses on the development.
1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.
People Graduates Rahul Satija - Footprinting and Statistical Alignment Joanna Davies - Integrative Genomics of Asthma Aziz Mithani - Comparison of Metabolic.
Information Systems Basic Core Specialization Clinical Imaging BioInformatics Public Health Computer Science Methods (formal models) Biomedical Decision.
Medical Informatics Basics
Medical Informatics Basics Lection 1 Associated professor Andriy Semenets Department of Medical Informatics.
Information Technology Lonnie Bentley, Professor and Head Department of Computer Technology (CPT) - and - H. E. (Buster) Dunsmore, Professor Department.
SYSTEMS BIOLOGY AND NEUROENGINEERING Christine P. Hendon, PhD Assistant Professor Electrical Engineering.
Gary Stormo by Andrew Bardee. History Born 1950 in South Dakota Undergraduate in Biology from Caltech PhD in Molecular Biology from University of Colorado.
Master’s Degrees in Bioinformatics in Switzerland: Past, present and near future Patricia M. Palagi Swiss Institute of Bioinformatics.
A New Oklahoma Bioinformatics Company. Microarray and Bioinformatics.
Lecture Title Name. Boston University Slideshow Title Goes Here 2 10/16/2015 Boston University.
Eberhard O. Voit  Professor and Georgia Research Alliance Eminent Scholar in Systems Biology, The Wallace H. Coulter Department of Biomedical Engineering.
Computing and Communications and Biology Molecular Communication; Biological Communications Technology Workshop Arlington, VA 20 February 2008 Jeannette.
What is Genetic Research?. Genetic Research Deals with Inherited Traits DNA Isolation Use bioinformatics to Research differences in DNA Genetic researchers.
CSCI 6900/4900 Special Topics in Computer Science Automata and Formal Grammars for Bioinformatics Bioinformatics problems sequence comparison pattern/structure.
Component 6 - Health Management Information Systems Unit 1-2 What is Health Informatics?
Lecture Title Name. Boston University Slideshow Title Goes Here 2 5/26/2016 Boston University.
Integrating the Bioinformatic Technology Group into your research programme Introduction People and Skills Examples Integrating the BTG Contacts BHRC Away.
Harbin Institute of Technology Computer Science and Bioinformatics Wang Yadong Second US-China Computer Science Leadership Summit.
Bioinformatics Core Facility Guglielmo Roma January 2011.
Ritesh Krishna Department Of Computer Science WPCCS July 1, 2008.
Biological Signal Detection for Protein Function Prediction Investigators: Yang Dai Prime Grant Support: NSF Problem Statement and Motivation Technical.
Bioinformatics The application of computer technology to the management of biological information
AdvancedBioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2002 Mark Craven Dept. of Biostatistics & Medical Informatics.
Bioinformatics MEDC601 Lecture by Brad Windle Ph# Office: Massey Cancer Center, Goodwin Labs Room 319 Web site for lecture:
EB3233 Bioinformatics Introduction to Bioinformatics.
Bioinformatics lectures at Rice University Li Zhang Lecture 11: Networks and integrative genomic analysis-3 Genomic data
An approach to carry out research and teaching in Bioinformatics in remote areas Alok Bhattacharya Centre for Computational Biology & Bioinformatics JAWAHARLAL.
COMPUTATIONAL BIOLOGIST DR. MARTIN TOMPA Place of Employment: University of Washington Type of Work: Develops computer programs and algorithms to identify.
Bioinformatics Dipl. Ing. (FH) Patrick Grossmann
Computational Biology and Genomics at Boston College Biology Gabor T. Marth Department of Biology, Boston College
1 Artificial Regulatory Network Evolution Yolanda Sanchez-Dehesa 1, Loïc Cerf 1, José-Maria Peña 2, Jean-François Boulicaut 1 and Guillaume Beslon 1 1.
Biomedical Informatics and Health. What is “Biomedical Informatics”?
1 Survey of Biodata Analysis from a Data Mining Perspective Peter Bajcsy Jiawei Han Lei Liu Jiong Yang.
Graduate Research with Bioinformatics Research Mentors Nancy Warter-Perez, ECE Robert Vellanoweth Chem and Biochem Fellow Sean Caonguyen 8/20/08.
Presenter: Bradley Green.  What is Bioinformatics?  Brief History of Bioinformatics  Development  Computer Science and Bioinformatics  Current Applications.
BME435 BIOINFORMATICS.
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
KnowEnG: A SCALABLE KNOWLEDGE ENGINE FOR LARGE SCALE GENOMIC DATA
Bioinformatics Madina Bazarova. What is Bioinformatics? Bioinformatics is marriage between biology and computer. It is the use of computers for the acquisition,
9 Future Challenges for Bioinformatics
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Genes to Function to Therapeutics
LESSON 1 INTNRODUCTION HYE-JOO KWON, Ph.D /
Introduction to Bioinformatic
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Presentation transcript:

Center for Bioinformatics and Genomic Systems Engineering Bioinformatics, Computational and Systems Biology Research in Life Science and Agriculture.

Aniruddha Datta Professor ECE Director CBGSE Research Focus Areas: Genomic Signal Processing and Control Systems Bio Research Focus: 1. Cancer Therapy Design using Pathway Logic 2. Exploiting Connections between Cancer and Metabolism 3. Heterogeneity of Cancer Tissue

Charles Johnson Director- Texas AgriLife Genomics and Bioinformatics Executive Director – Center Bioinformatics & Genomic Systems Engineering Genomic Technology Development Next Generation Sequencing Genomics Bioinformatics and Statistics Experimental Design

Krishna Narayanan Professor Associate Director CBGSE Director of Graduate Studies Electrical & Computer Engineering Research projects revolve around understanding the role of structured codes in multi-terminal information theory, joint source and channel coding for wireless communications, design and analysis of codes and decoders for applications in wireless communications, data storage and optical communications, information forwarding in wireless networks, design of message passing algorithms for solving Lagrangian dynamics problems.

Ulisses Braga-Neto Associate Professor Web: Telephone: (979) His research interests include small- sample error estimation, statistical pattern recognition, and genomic signal processing, with applications in the study of cancer and infectious diseases.

Xiaoning Qian Position: Assistant Professor Telephone: Research Interest Bioinformatics: – Analysis and intervention in biological networks; – Functional data analysis on genomic and proteomic datasets. Biomedical image processing and analysis: – Image segmentation and robust boundary finding; – Shape-based similarity retrieval in multimedia databases.

Byung-Jun Yoon Position: Associate Professor Web: Telephone: (979) Genomic Signal Processing (GSP), Bioinformatics, and Systems Biology Probabilistic Graphical Models & Algorithms, and Their Application in Computational Biology, Noncoding RNA (ncRNA) Prediction, RNA Sequence Analysis, Network Biology & Comparative Analysis of Biological Networks

Peng Yu Assistant Professor, ECE, TAMU Web: Statistical HTS data analysis Regulation of gene expression Genomics of complex diseases Metagenomics Structural genomics

Yang Shen Assistant Professor Web: Research interests: Modeling, simulation, and engineering of biomolecules and bimolecular systems. Ph.D., Systems Engineering, Boston University, 2008 B.E., Automation, University of Science and Technology of China, 2002 Computational Molecular Biology, Structural prediction of protein interactions, Drug design, Computational Systems Biology, Systems therapeutics, Synthetic biology, Bioinformatics,. Optimization and learning, Systems and control

Jean-Francois Chamberland- Tremblay Associate Professor: Electrical & Computer Engineering His research interests are in the areas of communication and information theory, decision and control, computer systems and networks, statistical inference, learning, and applied probability.

Tie Liu Associate Professor Electrical & Computer Engineering His primary research interest is in the area of information theory and statistical information processing.

Chao Sima Position: Research Assistant Professor Jianping Hua Position: Research Assistant Professor Tao Hu Position: Research Assistant Professor Research Faculty

Noushin Ghaffari, Ph.D. Bioinformatics Scientist Genomics and Bioinformatics Service Telephone: (979) Head of bioinformatics consulting and training for AgriLife’s Genomics and Bioinformatics Unit. Research interest bioinformatics and method performance evaluation

Marcel Brun, Ph.D. Bioinformatics Analyst Genomics and Bioinformatics Service Head of software development with a research focused on genomics signal processing and machine learning. Formally head of algorithm development at TGen.

Shichen Wang, Ph.D. Bioinformatics Scientist Genomics and Bioinformatics Service (979) Research interests: statistical genetics, genotyping and sequencing related bioinformatics