Got Book? – Base Group Starter 3. Group Discussion Share out your three key learnings – every voice is heard Organize index cards, check for accurate completion of cards, turn in to Mr. B 2. Index Card –First and Last NamePeriod __ 1.Describe three things you learned from this assignment/reading 2.Describe the CELL THEORY in your own words 3.Give yourself a score out of 10 Based on Completion __/10 Based on Thoroughness of Answers ___/10 1. Group Roles Seat 1 – Runner – Get index card for everyone at your table Seat 2 – Checker – Check everyone’s HW for completion Seat 3 – Leads Discussion - Reporter Seat 4 – Responsible for Turn in

Missing Pieces 6 th Period Jenica – October Sky ? Luke M /Eliz / Francesco – Word Art? Calvin/Cassidy/Eliz – Quiz Retake? 8 th Period Emily L – Wordart, schedule quiz, book Kevin H – Quiz Retake? Roman – Wordart, schedule quiz Collin, Andrew – Finish Quiz Jordan – WORDART? Josh G – Book, Quiz Dooley/Diaz - Book 4 th Period Nevah – Finish Quiz, Book here Cody – Quiz? Cole – Makeup after absences Josh/Jenna/Dustin/Wyatt/Gwen – Retake? Science Fair Boards – Supplies – Please Take Home!! Regional Science Fair – Take Sheet – Forms due to me by Friday at 3 pm – Help session at 3:20 on Thursday --

Journal Entry Science in Solving Crimes/Mysteries List and describe as many TOOLS/Techniques used by scientists to solve a crime or mystery… What is the technical term used for a specialist that works in this area of science?

 Where is your DNA in one of your cells?  What does DNA look like?  How small is it?  Most importantly: Why is DNA called the “Blueprint of Life”?

Journal Entry Make a list of the organisms that have DNA.

DNA Deoxyribonucleic Acid

DNA up close and personal

Steps in a Nutshell – Recorder Copy this down 1.Put wheat germ into container (tube) 2.Add hot water -- Mix 3 minutes 3.Add detergent – Mix every minute for 5 minutes – Have a seat as a team 4.Remove Foam if any 5.Add Alcohol gently – set 1-3 minutes… the longer the better 6.Extract DNA “Macromolecules” using paperclip and cup 7.Clean Up – Put contents of container in big glass jar by the sink

DNA Extraction Lab Wheat germ comes from wheat seeds. The "germ" is the embryo, which is the part of the seed that can grow into a new wheat plant.

Water temperature The heat softens the fats in the membranes that surround the cell and the nucleus. It also inactivates enzymes (DNase) which, if present, would cut the DNA into such small fragments that it would not be visible.

Detergent Detergent contains sodium laurel sulfate, which cleans dishes by removing fats and proteins. It acts the same way in the DNA extraction, pulling apart the fats and proteins that make up the membranes surrounding the cell and nucleus. Once these membranes are broken apart, the DNA is released from the cell.

Alcohol The DNA released from the cell nucleus is dissolved in the water/detergent/wheat germ solution and cannot be seen. DNA precipitates (becomes more solid-like) in alcohol, where it can be seen. Besides allowing us to see the DNA, the alcohol separates the DNA from the other cell components, which are left behind in the water solution.

DNA structure Deoxyribonucleic acid Double helix –Double stranded –“twisted ladder” 3 parts –Phosphate group –Sugar (deoxyribose) –Nitrogen Bases

Nitrogen bases Base pair Rule A – T C – G ACTGCATACGGT TGACGTATGCCATGACGTATGCCA

Pioneers of DNA Chargaff Discovered that the number of A’s was the same as T’s and that the number of C’s was the same as G’s … but he didn’t know why …

Wilkins and Franklin They worked together in Wilkins lab but they didn’t get along very well. Roslind Franklin made an x-ray of DNA that showed it was a double helix but died from cancer before she got full credit. Wilkins got the Noble prize.

Watson and Crick These gentlemen took information from other scientists and their own information and devised the current model of DNA (1953)

Cool sites to learn more about genetics!!

Planner Filled Out DUE Thursday 1/20 –DNA Coloring + Question Sheet (use pg others) –Book Question page 62 #2 a,b,c Find an appropriate “What’s Hot in Science” Article – RELATED TO CELLS, GENETICS, etc Bring in a workable copy (ready for Annotation) – Due Next MONDAY