Scenarios for Discussion: #1. A Genetic disease “runs” in my family. I want to use IVF to screen for a baby who will NOT carry this dreaded disease. Why.

Slides:



Advertisements
Similar presentations
Lecture 41 Prof Duncan Shaw. Genetic Variation Already know that genes have different alleles - how do these arise? Process of mutation - an alteration/change.
Advertisements

Traits & Environment Pp What are traits? Hair color Eye color HeightWeight Male vs. Female.
KEY CONCEPT A combination of methods is used to study human genetics.
A mutant is different than “normal”. The mutant characteristic is passed on to the next generation.
DNA TECHNOLOGY: Part 1 Cloning & Stem Cell Research Nova video.
Unit 4 Genetics Ch. 14 The Human Genome.
DESIGNER BABIES. What?  Definition: The term used to define the genetic engineering of an embryo’s genes and genome in order to specify the genes of.
Chapter 11 Human Heredity.
KARYOTYPES & THE HUMAN GENOME. To analyze chromosomes, scientists photograph cells while they are undergoing mitosis when the chromosomes are fully condensed.
1 Modern Genetics Chapter 4. 2 Human Inheritance Some human traits are controlled by single genes with two alleles, and others by single genes with multiple.
Chapter 4 Modern Genetics Section 1 Human Inheritance
Chapter Four Modern Genetics. Lesson 4-1 Human Inheritance.
Modern Genetics Genetics since Mendel.
Genetic Material Chromosomes are found in the nuclei of an organism’s cells. They are tightly coiled strands of DNA. DNA is a very long molecule that holds.
CLONING 101. cloning is the creation of an organism that is the EXACT genetic copy of another –Identical twins are natural clones Cloning can be done.
Ethics of Biotechnology. CLONING What is CLONING? Creating new and identical organisms using biotechnology.
Gene Mutations. What are mutations and where do they occur?
 Taking an organ from one organism and placing it in another to function Pros -Can save lives -Living individuals can donate organs Cons -Worry of doctors.
HUMAN GENETICS. Objectives 2. Discuss the relationships among chromosomes, genes, and DNA. 2.8 Examine incomplete dominance, alleles, sex determination,
Allele. Alternate form of a gene gene variant autosome.
Human Genetics.
KEY CONCEPT A combination of methods is used to study human genetics.
Human Genetics and the Pedigree. Section Objectives Understand how different mutations occur. Be able to identify different diseases and disorders.
HUMAN HEREDITY OBJECTIVES: 14.1
Chapter 14 - The Human Genome
Genetic Disorders Ch. 5 section 2.
IVF A scientific method of making a woman pregnant, which does not involve sex. Conception occurs via sperm and egg being placed into a test tube. Embryo.
Clones and the Human Genome Project Unit 11 Lesson 3.
Genome Human Genome = the sequence of DNA nitrogenous bases found on the 23 sets of chromosomes in humans Human Genome Project (HGP) = a collaborative.
3 RD BLOCK WARM-UP 1. Have out your homework (Graphic Organizer). 2. After I check it, go check your answers at the SSS. 3. Open your Biology Handbook.
Genetic Disorders and Genetic Testing © 2010 Project Lead The Way, Inc.Medical Interventions.
Chap 6 notes Human Inheritance. Karyotype Shows all 46 human chromosomes 23 pairs Chromosomes 1-22 are autosomes (regular chromosomes) The last set of.
7.4 Human Genetics and Pedigrees TEKS 6F, 6H The student is expected to: 6F predict possible outcomes of various genetic combinations such as monohybrid.
Bio 101 Sequencing Our Genome: Background. How can a black female dog have yellow, brown, and black puppies?
Genetic Disorders and Genetic Testing
Genetics: Inheritance. Meiosis: Summary  Diploid Cells (2n): Cells with two sets of chromosomes, (aka “homologous chromosomes”)  One set of chromosomes.
Chapter 11 Human Heredity.
13.2 – Human Genetic Disorders
A scientific method of making a woman pregnant, which does not involve sex. Conception occurs via sperm and egg being placed into a test tube.
KEY CONCEPT A combination of methods is used to study human genetics.
Genetic Disorders and Genetic Testing
The human genome Contains all the genetic material of an individual
Genes Genes play an important role in our physical appearance.
Ethics in Biotechnology
The Human Genome Project
The Human Genome Project
KEY CONCEPT A combination of methods is used to study human genetics.
KEY CONCEPT A combination of methods is used to study human genetics.
Genetics: Inheritance
Genetic Testing.
KEY CONCEPT A combination of methods is used to study human genetics.
Complex Traits Qualitative traits. Discrete phenotypes with direct Mendelian relationship to genotype. e.g. black or white, tall or short, sick or healthy.
Chapter 11 Human Heredity.
KEY CONCEPT A combination of methods is used to study human genetics.
What gender is XX female.
Human Karyotypes and Heredity
Genetics: Inheritance
HUMAN HEREDITY.
Polymerase Chain Reaction
Genetic Disorders and Genetic Testing
Genetic Disorders and Genetic Testing
Human Genetics and Pedigrees
Biotechnology.
Biotechnology Genetic Engineering
KEY CONCEPT A combination of methods is used to study human genetics.
Mitosis & Meiosis What’s the difference?.
KEY CONCEPT A combination of methods is used to study human genetics.
KEY CONCEPT A combination of methods is used to study human genetics.
KEY CONCEPT A combination of methods is used to study human genetics.
Presentation transcript:

Scenarios for Discussion: #1. A Genetic disease “runs” in my family. I want to use IVF to screen for a baby who will NOT carry this dreaded disease. Why not? #2. My five year old child has a deadly form of cancer and needs a bone marrow transplant. I want to have a baby that has exactly the same rare “tissue type” so they can be a donor and save my beautiful child. Why not? #3. I want to have another child. I want this child to be healthy, physically “stunning”, and have amazing innate musical ability. Why not?

What Technological Advances will make “Designer Babies” Possible? 1. Genomics (understanding of how DNA “programs” life). - DNA sequencing -Epigenomic modification 2. In Vitro Fertilization (manipulate embryos outside of the body). 3. Genetic Engineering (engineer novel DNA information in any life form). - artificial chromosomes

“The Central Dogma”

Life is Programmed by DNA The Human Genome contains 3 billion base pairs: 3,000,000,000

CTCGAGGGGCCTAGACATTGCCCTCCAGAGAGAGCACCCAACACCCTCCAGGCTTGACCGGCCAGGGTGTCCCCTTCCTACCTTGGAGAGAGCAGCCCCAGGGCATCC TGCAGGGGGTGCTGGGACACCAGCTGGCCTTCAAGGTCTCTGCCTCCCTCCAGCCACCCCACTACACGCTGCTGGGATCCTGGATCTCAGCTCCCTGGCCGACAACACT GGCAAACTCCTACTCATCCACGAAGGCCCTCCTGGGCATGGTGGTCCTTCCCAGCCTGGCAGTCTGTTCCTCACACACCTTGTTAGTGCCCAGCCCCTGAGGTTGCAGC TGGGGGTGTCTCTGAAGGGCTGTGAGCCCCCAGGAAGCCCTGGGGAAGTGCCTGCCTTGCCTCCCCCCGGCCCTGCCAGCGCCTGGCTCTGCCCTCCTACCTGGGCTC CCCCCATCCAGCCTCCCTCCCTACACACTCCTCTCAAGGAGGCACCCATGTCCTCTCCAGCTGCCGGGCCTCAGAGCACTGTGGCGTCCTGGGGCAGCCACCGCATGTC CTGCTGTGGCATGGCTCAGGGTGGAAAGGGCGGAAGGGAGGGGTCCTGCAGATAGCTGGTGCCCACTACCAAACCCGCTCGGGGCAGGAGAGCCAAAGGCTGGGT GTGTGCAGAGCGGCCCCGAGAGGTTCCGAGGCTGAGGCCAGGGTGGGACATAGGGATGCGAGGGGCCGGGGCACAGGATACTCCAACCTGCCTGCCCCCATGGTCT CATCCTCCTGCTTCTGGGACCTCCTGATCCTGCCCCTGGTGCTAAGAGGCAGGTAAGGGGCTGCAGGCAGCAGGGCTCGGAGCCCATGCCCCCTCACCATGGGTCAGG CTGGACCTCCAGGTGCCTGTTCTGGGGAGCTGGGAGGGCCGGAGGGGTGTACCCCAGGGGCTCAGCCCAGATGACACTATGGGGGTGATGGTGTCATGGGACCTGG CCAGGAGAGGGGAGATGGGCTCCCAGAAGAGGAGTGGGGGCTGAGAGGGTGCCTGGGGGGCCAGGACGGAGCTGGGCCAGTGCACAGCTTCCCACACCTGCCCAC CCCCAGAGTCCTGCCGCCACCCCCAGATCACACGGAAGATGAGGTCCGAGTGGCCTGCTGAGGACTTGCTGCTTGTCCCCAGGTCCCCAGGTCATGCCCTCCTTCTGCC ACCCTGGGGAGCTGAGGGCCTCAGCTGGGGCTGCTGTCCTAAGGCAGGGTGGGAACTAGGCAGCCAGCAGGGAGGGGACCCCTCCCTCACTCCCACTCTCCCACCCC CACCACCTTGGCCCATCCATGGCGGCATCTTGGGCCATCCGGGACTGGGGACAGGGGTCCTGGGGACAGGGGTCCGGGGACAGGGTCCTGGGGACAGGGGTGTGG GGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTCCGGGGACAGGGGTGTGGGGACA GGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTCCTGGGGACAGGGGTGTGGGGACAGGG GTGTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCCTGGGGATAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCCCGGGGACAGGGGTG TGGGGACAGGGGTGTGGGGACAGGGGTCCTGGGGACAGGGGTCTGAGGACAGGGGTGTGGGCACAGGGGTCCTGGGGACAGGGGTCCTGGGGACAGGGGTCCTG GGGACAGGGGTCTGGGGACAGCAGCGCAAAGAGCCCCGCCCTGCAGCCTCCAGCTCTCCTGGTCTAATGTGGAAAGTGGCCCAGGTGAGGGCTTTGCTCTCCTGGAG ACATTTGCCCCCAGCTGTGAGCAGGGACAGGTCTGGCCACCGGGCCCCTGGTTAAGACTCTAATGACCCGCTGGTCCTGAGGAAGAGGTGCTGACGACCAAGGAGAT CTTCCCACAGACCCAGCACCAGGGAAATGGTCCGGAAATTGCAGCCTCAGCCCCCAGCCATCTGCCGACCCCCCCACCCCGCCCTAATGGGCCAGGCGGCAGGGGTTG ACAGGTAGGGGAGATGGGCTCTGAGACTATAAAGCCAGCGGGGGCCCAGCAGCCCTCAGCCCTCCAGGACAGGCTGCATCAGAAGAGGCCATCAAGCAGGTCTGTT CCAAGGGCCTTTGCGTCAGGTGGGCTCAGGGTTCCAGGGTGGCTGGACCCCAGGCCCCAGCTCTGCAGCAGGGAGGACGTGGCTGGGCTCGTGAAGCATGTGGGGG TGAGCCCAGGGGCCCCAAGGCAGGGCACCTGGCCTTCAGCCTGCCTCAGCCCTGCCTGTCTCCCAGATCACTGTCCTTCTGCCATGGCCCTGTGGATGCGCCTCCTGCC CCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGA ACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCTGCCCCTGGCCGCCCCCAGCCACCCCCTGCTCCTG GCGCTCCCACCCAGCATGGGCAGAAGGGGGCAGGAGGCTGCCACCCAGCAGGGGGTCAGGTGCACTTTTTTAAAAAGAAGTTCTCTTGGTCACGTCCTAAAAGTGAC CAGCTCCCTGTGGCCCAGTCAGAATCTCAGCCTGAGGACGGTGTTGGCTTCGGCAGCCCCGAGATACATCAGAGGGTGGGCACGCTCCTCCCTCCACTCGCCCCTCAA ACAAATGCCCCGCAGCCCATTTCTCCACCCTCATTTGATGACCGCAGATTCAAGTGTTTTGTTAAGTAAAGTCCTGGGTGACCTGGGGTCACAGGGTGCCCCACGCTGC CTGCCTCTGGGCGAACACCCCATCACGCCCGGAGGAGGGCGTGGCTGCCTGCCTGAGTGGGCCAGACCCCTGTCGCCAGCCTCACGGCAGCTCCATAGTCAGGAGAT GGGGAAGATGCTGGGGACAGGCCCTGGGGAGAAGTACTGGGATCACCTGTTCAGGCTCCCACTGTGACGCTGCCCCGGGGCGGGGGAAGGAGGTGGGACATGTGG GCGTTGGGGCCTGTAGGTCCACACCCAGTGTGGGTGACCCTCCCTCTAACCTGGGTCCAGCCCGGCTGGAGATGGGTGGGAGTGCGACCTAGGGCTGGCGGGCAGG CGGGCACTGTGTCTCCCTGACTGTGTCCTCCTGTGTCCCTCTGCCTCGCCGCTGTTCCGGAACCTGCTCTGCGCGGCACGTCCTGGCAGTGGGGCAGGTGGAGCTGGG CGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCT GGAGAACTACTGCAACTAGACGCAGCCTGCAGGCAGCCCCACACCCGCCGCCTCCTGCACCGAGAGAGATGGAATAAAGCCCTTGAACCAGCCCTGCTGTGCCGTCTG TGTGTCTTGGGGGCCCTGGGCCAAGCCCCACTTCCCGGCACTGTTGTGAGCCCCTCCCAGCTCTCTCCACGCTCTCTGGGTGCCCACAGGTGCCAACGCCAGGCAGGCC CAGCATGCAGTGGCTCTCCCCAAAGCGGCCATGCCTGTTGGCTGCCTGCTGCCCCCACCCTGTGGCTCAGGGTCCAGTATGGGAGCTTCGGGGGTCTCTGAGGGGCCA GGGATGGTGGGGCCACTGAGAAGTGACTCTGTCAGTAGCCGACCTGGAGTCCCCAGAGACCTTGTTCAGGAAAGGGAATGAGAACATTCCAGCAATTTTCCCCCCACC TAGCCCTCCCAGGTTCTATTTTTAGAGTTATTTCTGATGGAGTCCCTGTGGAGGGAGGAGGCTGGGCTGAGGGAGGGGGTCCTGCAGGGCGGGGGGCTGGGAAGGT GGGGAGAGGCTGCCGAGAGCCACCCGCTATCCCCAGCTCTGGGCAGCCCCGGGACAGTCACACACCCTGGCCTCGCGGCCCAAGCTGGCAGCCGTCTGCAGCCACAG CTTATGCCAGCCCAGGTCCAGCCAGACACCTGAGGGACCCACTGGTGCCTTGGAGGAAGCAGGAGAGGTCAGATGGCACCATGAGCTGGGGCAGGTGCAGGGACCG TGG

Genomics

Inheritance of Genetic Disease (eg. Sickle Cell Anemia)

(Mutations change the Genotype) Genotype  Phenotype (Expressed Trait)

Normal Human Karyotype (female)

Scenarios for Discussion: #1. A Genetic disease “runs” in my family. I want to use IVF to screen for a baby who will NOT carry this dreaded disease. Why not? #2. My five year old child has a deadly form of cancer and needs a bone marrow transplant. I want to have a baby that has exactly the same rare “tissue type” so they can be a donor and save my beautiful child. Why not? #3. I want to have another child. I want this child to be healthy, physically “stunning”, and have amazing innate musical ability. Why not?

“Savior Sister”

Scenarios for Discussion: #1. A Genetic disease “runs” in my family. I want to use IVF to screen for a baby who will NOT carry this dreaded disease. Why not? #2. My five year old child has a deadly form of cancer and needs a bone marrow transplant. I want to have a baby that has exactly the same rare “tissue type” so they can be a donor and save my beautiful child. Why not? #3. I want to have another child. I want this child to be healthy, physically “stunning”, and have amazing innate musical ability. Why not?

Phenotypes: Aging ( 114 vs 15 years) Complex “multifactorial” trait versus a single change in one gene. Hutchinson-Gilford Progeria syndrome

Genetic Diversity

A Normal Distribution

Broad Sense Heritability: How we measure the genetic contribution to complex traits in humans. H 2 = S 2 Genotypic = S 2 Genotypic S 2 Total PhenotypicS 2 Genotypic + S 2 Environmental Human TraitH 2 Longevity29 Height85 Weight63 Max Heart Rate84 Verbal Ability63 Mathematical Ability76 Temperament Index58 Human Twin Studies

Beethoven the “Genius”

Genetic Engineering

Cloning Technology “Dolly”

Scenarios for Discussion: #1. A Genetic disease “runs” in my family. I want to use IVF to screen for a baby who will NOT carry this dreaded disease. Why not? #2. My five year old child has a deadly form of cancer and needs a bone marrow transplant. I want to have a baby that has exactly the same rare “tissue type” so they can be a donor and save my beautiful child. Why not? #3. I want to have another child. I want this child to be healthy, physically “stunning”, and have amazing innate musical ability. Why not?