DNA, RNA, and Gene Expression Chapter 14. Remember DNA’s structure allows it to do 3 things… DNA’s structure allows it to do 3 things… - But….the structure.

Slides:

Advertisements

Similar presentations

How is RNA Transcribed from DNA

Advertisements

RNA and Protein Synthesis

Chapter 13: RNA and Protein Synthesis

Chapter 13: RNA and Protein Synthesis

Transcription & Translation Biology 6(C). Learning Objectives Describe how DNA is used to make protein Explain process of transcription Explain process.

What makes you look like your parents? Your parents passed down their DNA to you. What’s carried in your DNA that gives you your traits & characteristics?

2.7 DNA Replication, transcription and translation

DNA Structure Replication Functions (Stores and provides copies of genetic material- genes) – Blueprint (genes) for Protein Synthesis (Enzymes and cell.

PROTEIN SYNTHESIS.

Nucleic Acids DNA vs. RNA

RNA carries DNA’s instructions.

Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis

Review Describe the three main difference between RNA and DNA

Protein Synthesis 12-3.

RNA. ________ are coded DNA instructions that control the ___________ of proteins. Genetic ______________ can be decoded by copying part of the ___________.

 We know that DNA is the genetic material and its sequence of nucleotide bases carry some sort of code. This code holds instructions that tell a cell.

Chapter 12 Making Proteins. Differences between RNA and DNA DNA = double strand; RNA = single strand RNA contains Ribose instead of deoxyribose. RNA uses.

Do Now: On the “Modeling DNA” handout, determine the complimentary DNA sequence and the mRNA sequence by using the sequence given.

RNA Chapter Structure of RNA Ribose- the sugar molecule of every RNA nucleotide Uracil- nitrogen-containing pyrimidine base (replaces thymine) Uracil.

RNA and Protein Synthesis

12-3 RNA and Protein Synthesis

DNA, mRNA, and Protein Synthesis TAKS Review for April 22 test.

Protein Synthesis Part II. Translation. Review-What is the central dogma? The central dogma describes the flow of information from DNA to RNA to proteins.

TRANSCRIPTION AND TRANSLATION. Transcription notes Point of Transcription – to make an accurate small piece of an organisms DNA Point of Transcription.

What is central dogma? From DNA to Protein

Nucleic Acids Comparing DNA and RNA. Both are made of nucleotides that contain  5-carbon sugar,  a phosphate group,  nitrogenous base.

Chapter 13 –RNA and Protein Synthesis

The student is expected to: 4B investigate and explain cellular processes, including homeostasis, energy conversions, transport of molecules, and synthesis.

8.4 Transcription KEY CONCEPT Transcription converts a gene into a single-stranded RNA molecule.

8.4 Transcription KEY CONCEPT Transcription converts a gene into a single-stranded RNA molecule. NEW VOCABULARY (Def. on next 2 slides) Central Dogma RNA.

Question of the DAY Jan 14 During DNA Replication, a template strand is also known as a During DNA Replication, a template strand is also known as a A.

RNA and Protein Synthesis Chapter How are proteins made? In molecular terms, genes are coded DNA instructions that control the production of.

Placed on the same page as your notes Warm-up pg. 48 Complete the complementary strand of DNA A T G A C G A C T Diagram 1 A T G A C G A C T T A A C T G.

8.4 Transcription TEKS 4B, 6C, 9C The student is expected to: 4B investigate and explain cellular processes, including homeostasis, energy conversions,

Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.

DNA Structure Replication Functions (Stores and provides copies of genetic material- genes) – Blueprint (genes) for Protein Synthesis (Enzymes and cell.

12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.

RNA. Learning Objectives  Contrast RNA and DNA.  Explain the process of transcription.

RNA and Transcription. Genes Genes are coded DNA instructions that control the production of proteins within the cell To decode the genetic message, you.

Protein Synthesis - Transcription

Gene Expression and Protein Synthesis

Notes: Transcription DNA vs. RNA

RNA Ribonucleic Acid Single-stranded

(3) Gene Expression Gene Expression (A) What is Gene Expression?

Transcription: DNA  mRNA

12-3 RNA and Protein Synthesis

Protein Synthesis.

BIOLOGY NOTES GENETICS PART 7 PAGES

RNA & Protein Synthesis

DNA Transcription & Protein Translation

BIOLOGY NOTES GENETICS PART 7 PAGES

RNA Ribonucleic Acid.

Transcription & Translation.

Transcription -The main purpose of transcription is to create RNA from DNA because RNA leaves the nucleus to carry out its functions but DNA does not -A.

RNA carries DNA’s instructions.

RNA carries DNA’s instructions.

BIOLOGY NOTES GENETICS PART 7 PAGES

Protein Synthesis Lecture 5

RNA and Transcription DNA RNA PROTEIN.

RNA is a nucleic acid made of linked nucleotides.

Transcription & Translation

DNA & RNA Protein Synthesis.

RNA is a nucleic acid made of linked nucleotides.

BIOLOGY NOTES GENETICS PART 7 PAGES

DNA Transcription and Translation

Protein Synthesis.

Transcription and the RNA code

Presentation transcript:

DNA, RNA, and Gene Expression Chapter 14

Remember DNA’s structure allows it to do 3 things… DNA’s structure allows it to do 3 things… - But….the structure does NOT explain how the gene actually WORKS…. But….the structure does NOT explain how the gene actually WORKS…. -

DNA vs RNA - Sugar is - Sugar is - Contains - Contains - “Working copy” “Working copy”

Types of RNA - mRNA mRNA Ribosomal RNA Ribosomal RNA - tRNA tRNA

The Process of RNA Production RNA synthesis = - RNA synthesis = - Process: - Process: - A strand of DNA acts as a template A strand of DNA acts as a template RNA strand grows based on the complementary nucleotide of the parent strand RNA strand grows based on the complementary nucleotide of the parent strand - -

Transcription - Uses 1 strand as a template Uses 1 strand as a template -

Transcription RNA polymerase binds to - RNA polymerase binds to - - Once at the end, DNA and RNA strands are released Once at the end, DNA and RNA strands are released

Transcription

Post Transcriptions Modifications Not all nucleotides are involved in coding for proteins Not all nucleotides are involved in coding for proteins - - All can remain or some are removed in various combinations All can remain or some are removed in various combinations -

mRNAs Transcripts that become mRNA are further tailored Transcripts that become mRNA are further tailored adenines adenines

DNA vs. RNA DNA = “master blueprint” -. Don’t want to lose it!! DNA = “master blueprint” -. Don’t want to lose it!! RNA = “Disposable Copy”, “Working Copy” carries - RNA = “Disposable Copy”, “Working Copy” carries -

Question If the DNA strand below served as a template for an RNA molecule, what would be the complementary strand? If the DNA strand below served as a template for an RNA molecule, what would be the complementary strand? DNA : T G C T A C A A T DNA : T G C T A C A A T RNA : RNA :