PCR mediated mutagenesis

Slides:



Advertisements
Similar presentations
PCR Techniques. Basics of PCR Primers –15-60bp (60bp is limit synthesized by IDT) –Annealing temp ideally >55C (portion that anneals to your template)
Advertisements

Subcloning Techniques
JY BB JK JK CS LE MG AR NG JS SJ YW MK DS LL DH JB.
Molecular cloning overview Steps to prepare vector hour overnight culture 2.Minipreps (day immediately following O/N) (use Qiaprep spin miniprep.
Dolly the sheep ( ) 1. Animal and human cloning 2. Gene cloning.
PCR Basics Purpose of PCR Overview Components of PCR Reaction
PCR Basics 1.Purpose of PCR 2.Overview 3.Components of PCR Reaction 4.Variables Temperature Cycle Times and Numbers Primer Buffer Polymerase 5.Experimental.
Chemical Synthesis, Sequencing, and Amplification of DNA
Analysis of Gene Expression of Arabidopsis using RT-PCR and DNA Cloning Presented by Neha Jain ABE Workshop 2006 June 30, 2006.
General Genetics. PCR 1.Introduce the students to the preparation of the PCR reaction. PCR 2.Examine the PCR products on agarose gel electrophoresis.
Genomic DNA purification
CULTURE INDEPENDENT ANALYSIS OF MICROBIAL COMMUNITIES IN SOIL
EDVOKIT#300: Blue/White Cloning of a DNA Fragment
Lab safety Documentation, GLP Practical tips; primers and PCR.
Genetics Techniques: RFLP & PCR AP Biology Unit 3.
DNA Cloning and PCR.
Gateway cloning system
PCR Troubleshooting Virginia Balke
CHMI 4226E - W20051 Recombinant DNA Technology CHMI 4226 E Week of March 2, 2009 Mutagenesis.
PCR Related Products.
Lab meeting Noh ji eun. Calreticulin PCR purification -AccuPrep PCR purifiction kit -Components Buffer 1 (PCR Binding buffer) 250 ㎕ Buffer.
The polymerase chain reaction
The polymerase chain reaction
Polymerase Chain Reaction A process used to artificially multiply a chosen piece of genetic material. May also be known as DNA amplification. One strand.
DNA Science. Restriction Digest Restriction Digestion is the process of cutting DNA molecules into smaller pieces with special enzymes called Restriction.
Lecture 18 DNA Technology.
Amplification of a DNA fragment by Polymerase Chain Reaction (PCR) Ms. Nadia Amara.
Molecular Genetic Technologies Gel Electrophoresis PCR Restriction & ligation Enzymes Recombinant plasmids and transformation DNA microarrays DNA profiling.
CLONING DNA PART II. REVIEW: CHALLENGE REMEMBER THIS?
PCRPCR Presented by : Rana AL-Turki. 1- Definition of PCR. 2- Requirements for PCR. 3-PCR Process. 4-Procedure.
Introduction to PCR Polymerase Chain Reaction
Lab 22 Goals and Objectives: EDVOKIT#300: Blue/White Cloning of a DNA Fragment Calculate transformation efficiencies Compare control efficiency to cloned.
PKS Plasmid : 20 ul 10XTango Buffer : 3 ul SmaI (1u/ul) : 1 ul Distilled dH2O : 6 ul 30 ul.
PCR-mediated mutagenesis
PCR mediated mutagenesis 2013 년도 2 학기 생화학 실험 (2) 5 주차 조교 : 안성원.
분자생물학실험 SUBJECT Mini-prep, Restriction Enzyme
Preparation of Midi-Scale Plasmid DNA from E
이희두. Polymerase Chain Reaction  Technique widely used in molecular biology  With PCR it is possible to amplify a single or few copies of DNA across.
Lecturer: Bahiya Osrah Background PCR (Polymerase Chain Reaction) is a molecular biological technique that is used to amplify specific.
Gene Cloning 분자생물학실험 이효민 DNA Cloning DNA cloning is a technique for reproducing DNA fragments. It can be achieved by two different approaches:
Rajan sharma.  Polymerase chain reaction Is a in vitro method of enzymatic synthesis of specific DNA sequences.  This method was first time developed.
Protein Overexpression in E. coli and
Plasmid mini prep DNA electrophoresis Transformation(Expression)
Polymerase Chain Reaction. Before PCR Before PCR Recombinant Recombinant DNA DNA technology technology.
Basic Tools: Recombinant DNA Techniques Cut Purified DNA with Restriction Enzymes Transform E. coli Purified plasmid DNA Various restriction enzymes T4.
PCR Polymerase Chain Reaction Parviz Fallah Stem Cell Technology Research Centre.
Presented by: Khadija Balubaid.  PCR (Polymerase Chain Reaction) is a molecular biological technique  used to amplify specific fragment of DNA in vitro.
Introduction to PCR Polymerase Chain Reaction
The polymerase chain reaction (PCR)
PCR Basics Purpose of PCR Overview Components of PCR Reaction
SURVEY OF BIOCHEMISTRY Nucleic Acids continued… Amino Acids
Polymerase Chain Reaction (PCR)
Topics to be covered Basics of PCR
Molecular Genetics Bio350/516
EDVOKIT#300: Blue/White Cloning of a DNA Fragment
Jeopardy Final Jeopardy Gene Cloning Plasmids Ligase PCR $100 $100
Chapter 7 Recombinant DNA Technology and Genomics
Polymerase Chain Reaction (PCR)
MINIPREP.
The polymerase chain reaction (PCR)
Molecular Cloning: Polymerase Chain Reaction
COURSE OF MICROBIOLOGY
Gradient PCR using Taq polymerase with 125ng primer concentration
Biochemical experiment Gel extraction & Ligation
Polymerase Chain Reaction (PCR) technique
Polymerase Chain Reaction (PCR).
The polymerase chain reaction (PCR)
Biochemical experiment Gel extraction & Ligation
The polymerase chain reaction
The polymerase chain reaction (PCR)
Presentation transcript:

PCR mediated mutagenesis 2014년도 2학기 생화학 실험 (2) 6주차 조교 : 장지영, 신진철

Site-specific mutagenesis Introduction. Site-specific mutagenesis 1. Single base mutation. 2. Multiple mutation. 3. Insertion. 4. Deletion. The types of mutagenesis. The cause of mutagenesis. 1. UV. 2. Chemical-Carcinogen. 3. Error prone of PCR. 4. Site-directed mutagenesis.

Overlap Extension PCR 3’ 5’ 5’ 3’ 3’ 5’ 3’ 5’ 5’ 3’ 5’ 3’ 3’ 5’ 3’ 5’ 뺄 것 3’ 5’ 5’ 3’ 3’ 5’ 3’ 5’ 5’ 3’ 5’ 3’ Primer 2 Primer 1 3’ Primer 3 5’ 3’ 5’ Primer 4 5’ 3’ 5’ 3’ 1 Cycle 1 Cycle 2 Cycle 2 Cycle

Overlap Extension PCR Ligation PCR 1 Cycle 2 Cycle Primer로써 기능!!

Overlap Extension PCR 뺄 것 541 ttcacatgccctcagtgccgaaagagctttcctcggcggagcttc 586 cgccccaacctgcagctggccaatatggtccaggtgattcggcag 631 atgcacccaacccctggtcgagggagccgcgtgaccgatcagggc 676 atctgtcccaaacaccaagaagccctgaagctcttctgcgaggta 721 gacgaagaggccatctgtgtggtgtgccgagaatccaggagccac 766 aaacagcacagcgtggtgccattggaggaggtggtgcaggagtac 811 aaggccaaactgcaggggcacgtggaaccactgaggaagcacctg 856 gaggcagtgcagaagatgaaagccaaggaggagaggcgagtgaca 901 gaactgaagagccagatgaagtcagagctggcagcggtggcctcg 946 gagtttgggcgactgacacggtttctggctgaagagcaggcaggg

Experimental Procedure : Gel Extraction 1. Agarose gel : membrane binding solution = 10 mg : 10 ㎕ 씩 넣어 55℃ heat block에서 10분간 녹인다. 2. 잘 녹았는지를 vortexing 을 통해 확인 후, sample을 column으로 옮긴다. 3. 14000rpm, 1min centrifuge 4. Wash buffer 750 ㎕ 를 넣은 후 14000rpm, 1 min centrifug 5. 한번 더 14000rpm, 1 min centrifuge하여 남은 wash buffer를 제거한다. 6. Column을 새 tube에 옮긴 후 D.W.를 30 ㎕ 를 넣고 5분을 기다린다. 7. 14000rpm, 5 min centrifuge

Experimental Procedure : Ligation PCR PCR condition Ligation PCR PCR condition Component Quantity per reaction Targets 1-10kb Distilled water 34 ㎕ 5x Herculase II reaction buffer 10 ㎕ dNTP mix 0.5 ㎕ DNA template(1+3) 1 ㎕ DNA template(2+4) Primer 1+4 2.5 ㎕ Herculase II fusion DNA polymerase Total reaction volume 50 ㎕ Temp.(℃) Time 95 2 min 30 sec 55 72 1 min 5 min 30 cycles

PCR fragment for cloning into T-vector T-vector cloning. PCR fragment for cloning into T-vector PCR polymerase 의 종류 Taq DNA polymerase - 3’→5’ exonuclease 활성 없음 특이적으로 3’말단에 A가 생김. Pfu DNA polymerase 3’→5’ exonuclease 활성 있음 3’ 말단에 A가 생기지 않음 < alkaline phosphatase, Calf intestinal(CIP) >

Lac Z 을 이용한 selection Inhibitor Lactose Galactose Lactose β-galactosidase + Glucose X-Gal Blue color β-galactosidase + Glucose X-gal used to indicate whether a bacterium expresses the β-galactosidase enzyme, which is encoded by the lac Z gene, in a technique called blue/white screening.

Lac Z 을 이용한 selection

Amp/LacZ를 이용한 selection

PCR construct (insert) Experimental Procedure 1. T-vector ligation Ingredient Volume ( ul) 2x ligation buffer 5 T-vector 0.5 PCR construct (insert) 3.5 T4 DNA ligase 1 Total 10 Ligation time 1. Overnight at 16 ℃ 2. 1 ~ 2 hours at Room temperature ◈ Ligation volume setting ng of vector ng of insert : = 1 : 5 size of vector size of insert

Experimental Procedure 2. Transformation Positive control Self-ligation No insert Control insert (542bp)

Experimental Procedure 3. Bacteria culture 16hr 4. Plasmid DNA Extraction 5. Cloning confirmation using two-cut digestion

Membrane Wash Solution Membrane Binding Solution Report – 결과 및 고찰 1. Gel extraction solution 의 원리 조사 2. Lac operon원리와 selection의 원리에 대해서 쓰시오.(원리) 3. 수업자료에 있는 PCR의 2번 째 cycle 에서 합성되는 DNA를 그려보세요. 4. PCR-mediated PCR primer design (Red blank 인 부분을 deletion하는 construct, primer 4개 design 할 것) Design한 primer의 Tm 값과 annealing temperature를 구하시오. (Tm-5℃) Membrane Wash Solution 10mM potassium acetate (pH 5.0) 2. 80% ethanol 3. 16.7μM EDTA (pH 8.0) Membrane Binding Solution 1. 4.5M guanidine isothiocyanate 2. 0.5M potassium acetate

Report - 결과 및 고찰 1 atggctgccgttgccatgacacccaaccctgtgcagacccttcag 46 gaggaggcggtgtgcgccatctgcctcgattacttcacggacccc 91 gtgtccatcggctgcgggcacaacttctgccgagtttgtgtaacc 136 cagttgtggggtggggaggatgaggaggacagagatgagttagat 181 cgggaggaggaggaggaggacggagaggaggaggaagtggaggct 226 gtgggggctggcgcggggtgggacacccccatgcgggatgaagac 271 tacgagggtgacatggaggaggaggtcgaggaggaagaagagggt 316 gtgttctggaccagtggcatgagcaggtccagctgggacaacatg 361 gactatgtgtgggaggaggaggacgaggaggaagacctggactac 406 tacttgggggacatggaggaggaggacctgaggggggaggatgag 451 gaggacgaggaggaagtgctggaggaggttgaggaagaggatcta 496 gaccccgtcaccccactgcccccgcctccagcccctcggaggtgc 541 ttcacatgccctcagtgccgaaagagctttcctcggcggagcttc 586 cgccccaacctgcagctggccaatatggtccaggtgattcggcag 631 atgcacccaacccctggtcgagggagccgcgtgaccgatcagggc 676 atctgtcccaaacaccaagaagccctgaagctcttctgcgaggta 721 gacgaagaggccatctgtgtggtgtgccgagaatccaggagccac 766 aaacagcacagcgtggtgccattggaggaggtggtgcaggagtac 811 aaggccaaactgcaggggcacgtggaaccactgaggaagcacctg 856 gaggcagtgcagaagatgaaagccaaggaggagaggcgagtgaca 901 gaactgaagagccagatgaagtcagagctggcagcggtggcctcg 946 gagtttgggcgactgacacggtttctggctgaagagcaggcaggg 991 ctggaacggcgtctcagagagatgcatgaagcccagctggggcgt 1036 gcgggagccgcggctagtcgccttgcagaacaggccgcccagctc 1081 agccgcctgctggcagaggcccaggagcggagccagcaggggggt 1126 ctccggctgctccaggacatcaaggagactttcaataggtgtgaa

Report 제출기한 : 2014-10-23 오전까지(~12시) (늦게 제출 하면 감점) Hand-writing 제출기한 : 2014-10-23 오전까지(~12시) (늦게 제출 하면 감점) Hand-writing 미 제출 시 0점 처리 조교: 장지영(010-9493-9222) jyjang0809@naver.com