Population Structure High population divergence at the state level Populations from western Indiana genetically differed from the BONWR population Genetic Diversity BONWR showed lower diversity than western populations Unclear whether the population is natural and suffering from isolation or if the population is introduced and suffering from founder effect Further research needed to address cause of low diversity Implications for Kentucky Similar clustering of isolated populations in KY and IN We would expect to find similar genetic patterns in geographically separated KY populations BONWR Fine-scale genetic analysis 6-11 microsatellite loci to genotype frogs collected from eight sites on BONWR from the 2012 and 2013 breeding seasons. Intended to provide a better understanding of patterns of gene flow among crawfish frog populations at BONWR, yielding data necessary to inform management initiatives for this endangered species across its range Background Information Materials & Methods Conservation Genetics of Crawfish Frogs at Big Oaks National Wildlife Refuge Dana Leigh and Dr. Stephen Richter Department of Biological Sciences, Eastern Kentucky University, Richmond, KY Conservation Genetics of Crawfish Frogs at Big Oaks National Wildlife Refuge Dana Leigh and Dr. Stephen Richter Department of Biological Sciences, Eastern Kentucky University, Richmond, KY Results Discussion Acknowledgments Study Species and System References Crawfish Frog Populations in KY On-Going Research YEpr0KWShu5Omx2BhBB8tuW2PcnoKzXfDX7D5keannrGQzAEEYI Figure 3. Allelic richness of all sites. Figure 1. IBD of all sampling sites. Population Structure Genetic differences increased with geographic distance for all sampling sites as predicted by an isolation-by-distance model (P = ; R 2 = 0.897; Fig. 1). Using Structure analysis, BONWR was identified as a distinct population group, and HFWA and DP samples were determined to make up a second group (Fig. 2). Genetic Diversity Allelic richness was lower at BONWR and higher in the three HFWA sample sites and Dave’s Pond (Fig. 3). Figure 2. Structure output Crawfish frogs (Lithobates areolatus) are North American ranids that depend on crayfish burrows for their upland habitat. Crawfish frogs have been declining across their range and have been declared state endangered in Indiana and Iowa. The Hillenbrand Fish and Wildlife Area (HFWA) and Dave’s Pond (DP) in southwestern Indiana were sampled, along with the Big Oaks National Wildlife Refuge (BONWR). BONWR in southeastern Indiana, the easternmost locality of crawfish frog populations, houses recently discovered, isolated populations of crawfish frogs. The breeding ponds in BONWR are 90km from the nearest known crawfish frog population. Similar to the crawfish frog populations at BONWR, the crawfish frog populations of western Kentucky are at the easternmost edge of their range. The study of crawfish frogs at BONWR may therefore have implications for the management and conservation of crawfish frog populations in Kentucky. AGTCTAGCGCTAGTCACACACACACACACACACACACACACAACTTGTTGTTAGGC Flanking region Microsatellite Samples 189 individuals captured at drift fences Toe clips from reproductive adults DNA extraction Polymerase chain reaction (PCR) and genotyping Microsatellite DNA Short tandem repeats Mostly non-coding regions of DNA High mutation rate: high variability among individuals Nunziata, S.O., M.J. Lannoo. J.R. Robb, D.R. Karns, S.L. Lance, and S.C. Richter Population and Conservation Geneticsof Crawfish Frogs, Lithobates areolatus, at their Northeastern Range Limit. Journal of Herpetology 47: We would like to thank S. Nunziata, J. Heemeyer, V. Kinney, N. Engbrecht, S. Lannoo, T. Wheat, A. Hoffman, P. Williams, A. Robinson, A. Leffel, and P. Lannoo. We would also like to thank Eastern Kentucky University’s Department of Biological Sciences. This project was partially funded by an NSF EPSCoR Research Scholars Program grant to DL.