Fire-fly luciferase Light Signal transduction Signals luciferase luciferin Genetic Screens in Arabidopsis: Luciferase screening for gene discovery CCD.

Slides:

Advertisements

Similar presentations

Problem Results: Question: 1. You screen two libraries- cDNA; genomic

Advertisements

Genetic Jigsaw Class instructions. Start of lesson Divide the classes into 6 groups: – Origin of replication – Repressor gene – Promoter – Multiple cloning.

Cloning Promoters Kelli Henry April 27, 2009.

Chapter 4: recombinant DNA

Arabidopsis Molecular Genetics HORT 301 – Plant Physiology October 31, 2007 Reading 1 (Alonso and Ecker (2006) Nature Reviews Genetics Reading 2 (Page.

Plant Molecular Genetics and Genetic Transformation HORT 301 – Plant Physiology November 1, 2010 Taiz and Zeiger – Chapter 2, Smith et al. (2010) – Chapter.

Genetics in the real world: Developing a new genetic system in bacteria Abigail Salyers

Genetic Jigsaw Class instructions. Start of lesson Divide the classes into 6 groups: – Origin of replication – Repressor gene – Promoter – Multiple cloning.

RECOMBINANT DNA TECHNIQUE

Trends in Biotechnology

Ethylene responses Developmental processes

Chapter 18-Genetic Engineering of Plants: Methodology

Location of features Human cytomegalovirus (CMV) immediate early promoter: 1–589 Enhancer region: 59–465; TATA box: 554–560; Transcription start point:

Figure S1: Ma et al., 2015 Supplementary Data 1: Southern blot of three individual plants per generation (T5, T6 and T7), following the digestion of genomic.

Enzyme activity (μmol mg protein-1 min -1 ) DAA Xu-142 Xu-142 fl mutant CIN VIN CWIN (C) Supplemental Figure 1 Control.

Lecture 7 Manipulation of foreign gene and secretion of foreign protein.

Chapter 26 Opener. Figure 26.1 Patterns of Early Shoot Development.

Chapter 12 Lecture Outline Molecular Techniques and Biotechnology.

GABI-KAT system Plasmid map of pAC161 used for tagging. Map of the binary transformation vector pAC161 that contains the SULr ORF (for resistance against.

Gene expression (signal intensity) Control Osmotic Salt Drought Root Control Gene expression (signal intensity) Treatment.

Figure S1. Schematic diagram of vector pU1391W used to study subcellular localization of proteins. RB and LB, right and left T-DNA border;; Hpt, hygromycin.

A) EF ATGGACAACTCAGCTCCAGACTCTTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60 HM ATGGACAACTCAGCTCCGGACTCCTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60.

Wsmutant a b Fig. S1 Morphology of the low-iron-sensitive mutant of Arabidopsis. (a) Wild type (Ws) and the low-iron-sensitive mutant (mutant) germinated.

Searching for Genes Important in Seed Development At1g19000 At1g74840 BY: Mike Douglas.

Arabidopsis Thaliana A Study of Genes and Embryo Development By Garen Polatoglu.

Plants and algae Fungi Metazoa Protist Supplementary Figure 1. Phylogenetic analysis of GlsA1/ZRF orthologs in different organisms. Coloured background.

Louis et al. Figure S1 Mean expression intensity Figure S1. MPL1 expression in Arabidopsis organs The Genevestigator tool (

Supplemental Figure 1. The cell death phenotype of fhy3 far1 double mutants. A. The cell death phenotype of fhy3-4 far1-2 mutant plants under LD conditions.

Additional Transformation Topics

Cui-Cui Zhang, Wen-Ya Yuan, Qi-Fa Zhang Molecular Plant

Supplemental Fig. S1 A B AtMYBS aa AtMYBS

Topics to be covers Basic features present on plasmids

a b LB T-DNA RB Par WT PAR1/LAT4 Actin2 5’UTR 3’UTR At1g31830 Intron c

Potassium Transporter KUP7 Is Involved in K+ Acquisition and Translocation in Arabidopsis Root under K+-Limited Conditions Min Han, Wei Wu, Wei-Hua Wu,

Supplemental Figure 1 A) B) C)

Supporting Information Figs S1-S5

New vector designs for expression and general-purpose vectors.

Spatial Auxin Signaling Controls Leaf Flattening in Arabidopsis

Consequences of T‐DNA insertion on SWP expression in swp mutant.

Zhu Hui-Fen , Fitzsimmons Karen , Khandelwal Abha , Kranz Robert G.

Volume 21, Issue 15, Pages (August 2011)

Volume 9, Issue 8, Pages (August 2016)

Volume 25, Issue 10, Pages (May 2015)

Volume 2, Issue 1, Pages (January 2009)

Volume 10, Issue 1, Pages (July 2004)

Volume 14, Issue 9, Pages (May 2004)

Luo Chongyuan , Durgin Brittany G. , Watanabe Naohide , Lam Eric

Kim Min Jung , Ciani Silvano , Schachtman Daniel P. Molecular Plant

Potassium Transporter KUP7 Is Involved in K+ Acquisition and Translocation in Arabidopsis Root under K+-Limited Conditions Min Han, Wei Wu, Wei-Hua Wu,

Volume 93, Issue 7, Pages (June 1998)

What Color is it?.

Volume 10, Issue 6, Pages (June 2017)

High Frequency Retrotransposition in Cultured Mammalian Cells

Volume 11, Issue 8, Pages (May 2015)

FLS2 Molecular Cell Volume 5, Issue 6, Pages (June 2000)

Volume 9, Issue 1, Pages (January 2016)

Identification of AR mutant defects in ABA, ethylene, and auxin response factors. Identification of AR mutant defects in ABA, ethylene, and auxin response.

Volume 10, Issue 1, Pages (January 2017)

Volume 9, Issue 8, Pages (August 2016)

Volume 5, Issue 6, Pages (November 2012)

Figure S1. Schematic representation of the RieskeFeS over-expression vector pGWRi used to transform Arabidopsis (Col-0). cDNA are under transcriptional.

Volume 6, Issue 6, Pages (November 2013)

Volume 2, Issue 1, Pages (January 2009)

Mitochondrial Perturbation Negatively Affects Auxin Signaling

Volume 25, Issue 7, Pages e4 (November 2018)

Volume 10, Issue 6, Pages (June 2017)

Identification of a ufo1 Candidate Gene from the Mapping Region.

Volume 12, Issue 12, Pages R412-R414 (June 2002)

Driver pathways and key genes in OSCC

Presentation transcript:

Fire-fly luciferase Light Signal transduction Signals luciferase luciferin Genetic Screens in Arabidopsis: Luciferase screening for gene discovery CCD camera

Biotic Hormones Transcription Factors (>500) Defence response Viruses, Bacteria, fungi Defence Signalling in Plants

Loss of function Gain of function -SA +SA Wild-type Gain of Function Mutant screening approach Mutagenised population

The pTluc promoter trap vector. A, Restriction map of the pTLuc vector. pg5, promoter of T-DNA gene 5; ori/pBR, replication origin from plasmid pBR322; ApR/bacterial ampicillin resistance marker pAg4, 3' poly(A + ) signal sequence of T-DNA gene4; hph, hygromycin phosphotransferase gene; pnos, nopaline synthase promoter; FFluc, firefly luciferase gene; pAE93, 3' polyA region of gene E93. B, Sequence of the right border (RB) region. Position of the T-DNA RB is shown by white letters on black background. Sequences of BamHI and SalI restriction sites are underlined. ATG of the FFLuc reporter gene is boxed. The position of oligonucleotides LC1, LC2, and LC3 is indicated by arrows.

Identification of luciferase gene fusions in the pTluc-transformed Arabidopsis population. A, Light image of 45 screened T 1 seedlings. B, Luminescence image of the screened plants. Different patterns of luciferase activity are detectable in three plants. C, Identification of a luciferase gene fusion in pooled seed stocks. Image of 500 screened seedlings. D, Detection of luminescence in the pooled seedlings.

Examples for characteristic luciferase expression patterns in tagged Arabidopsis plants. Images show 3- to 4-week-old plants in light (left) and the corresponding luminescence pattern (right). Colors correspond to increasing luminescence intensity in the following order: blue < green < yellow < red < white. Luminescence patterns: A, constitutive (L3033); B, all green organs (L0213) ; C, petioles and shoot tip (L6180); D, root (L6318); E, shoot apex (L6331); F, young leaves (L6365). G and H, Salt-responsive luciferase activity in T 2 plants, which were challenged by high-salt medium. Luminescence was recorded at 0, 2, and 6 h after transfer. G, Salt-induced luminescence in roots (L1518). H, Salt-repressed luminescence (L6177).