55-213: Introductory Molecular Biology Professor : Dr. Andrew Hubberstey Office: Biology Building room 326 Email: please use CLEW site! Office Hours: Wednesdays.

Slides:



Advertisements
Similar presentations
Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA.
Advertisements

Molecular Genetics DNA RNA Protein Phenotype Genome Gene
1 Genetics The Study of Biological Information. 2 Chapter Outline DNA molecules encode the biological information fundamental to all life forms DNA molecules.
Intro to Molecular Genetics RNA & Protein Synthesis 3/16/2011.
RNA and Protein Synthesis
. Class 1: Introduction. The Tree of Life Source: Alberts et al.
Introduction to Medical Genetics Fadel A. Sharif.
Introduction to Genomics BL 3300/FW 3300 Welcome.
Bioinformatics Student host Chris Johnston Speaker Dr Kate McCain.
Genetics and the Organism 10 Jan, Genetics Experimental science of heredity Grew out of need of plant and animal breeders for greater understanding.
BI420 – Course information Web site: Instructor: Gabor Marth Teaching.
Gene Regulation Cells switch on different sets of genes according to their position and their history. So in the pictures of the development of the zebra.
From Gene to Protein. Genes code for... Proteins RNAs.
Principles of Evolution Biology 3330 – Spring 2015 James F. Thompson, Ph.D.
Chromosomes carry genetic information
In the beginning, There was Mendel…. MEDICAL GENETICS Human Genetics
Welcome to Animal Behaviour BIOL Contact info Dr. Matt Reudink Office: S350 * to set up appointment or just drop
Your Family Health History
Genes as DNA: How Genes Encode Proteins
How Proteins are Made. I. Decoding the Information in DNA A. Gene – sequence of DNA nucleotides within section of a chromosome that contain instructions.
Elements of Molecular Biology All living things are made of cells All living things are made of cells Prokaryote, Eukaryote Prokaryote, Eukaryote.
Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis
Do Now Why is it important to learn about DNA and how can DNA be used to help people? NUA Notebook Check Today.
AP Biology Ch. 20 Biotechnology.
Unit 7- Cell Cycle, DNA, and Protein Synthesis
A day 3/14/ writing prompts at end of the table in a pile! If it’s not there then it’s a zero 2. Replication quiz 2- take this time to review your.
RNA and Protein Synthesis
RNA AND PROTEIN SYNTHESIS RNA vs DNA RNADNA 1. 5 – Carbon sugar (ribose) 5 – Carbon sugar (deoxyribose) 2. Phosphate group Phosphate group 3. Nitrogenous.
AP Biology Discussion Notes Wednesday 01/28/2015.
CHAPTER 12: GENETICS.
DNA Structure & Function. Perspective They knew where genes were (Morgan) They knew what chromosomes were made of Proteins & nucleic acids They didn’t.
Ch. 21 Genomes and their Evolution. New approaches have accelerated the pace of genome sequencing The human genome project began in 1990, using a three-stage.
Protein Synthesis: DNA CONTAINS THE GENETIC INFORMATION TO PRODUCE PROTEINS BUT MUST FIRST BE CONVERTED TO RND TO DO SO.
Warm up 11/21 What are 3 differences between DNA & RNA? What is a codon? What is the Start Codon (or amino acid)? What is the final product of translation?
CHAPTER 12 STUDY GUIDE MATER LAKES ACADEMY MR. R. VAZQUEZ BIOLOGY
BIMM118 Introductory Pharmacology Please turn OFF your cell phones!
Michael Cummings David Reisman University of South Carolina Gene Regulation Part 2 Chapter 9.
Regulation of Gene Expression. You Must Know The functions of the three parts of an operon. The role of repressor genes in operons. The impact of DNA.
REVIEW. Protein Synthesis AT-A-GLANCE Translation.
Control of Gene Expression Year 13 Biology. Exceptions to the usual Protein Synthesis Some viruses contain RNA and no DNA. RNA is therefore replicated.
Gene Regulations and Mutations
Dr. Kathleen Hill Assistant Professor Department of Biology The University of Western Ontario Office Hours: Monday 1 to 5pm Room 333 Western.
Genetics Review Honors Human Anatomy & Physiology Mr. Mazza
The Future of Genetics Research Lesson 7. Human Genome Project 13 year project to sequence human genome and other species (fruit fly, mice yeast, nematodes,
Microbial Genetics.  In bacteria genetic transfer (recombination) can happen three ways:  Transformation  Transduction  Conjugation  The result is.
RNA Makin’ Proteins DNAMutations Show off those Genes!
Starter What do you know about DNA and gene expression?
1/15-19/16 Starter: 1/15 What do you know about genes? 1/19 1/15-19/ Gene Expression and Cell Differentiation Practice/Application/Connection.
Human Genomics Higher Human Biology. Learning Intentions Explain what is meant by human genomics State that bioinformatics can be used to identify DNA.
1 From Bi 150 Lecture 0 October 4, 2012 An introduction to molecular biology... but you will learn the cell biology in this course.
Chapter 10-How Protein are Made Section 1-From Genes to Proteins – Traits are determined by proteins, that are built by DNA. – Proteins are NOT built by.
DNA TO PROTEIN Biology - 9. Monday, Nov. 25 th  Objective: Students will put the vocabulary of DNA and protein synthesis into context.  Go Over Test.
Gene structure and function
RNA & Protein Synthesis
Michelle Smith Instructor: Contact Information:
SC.912.L.16.3 DNA Replication. – During DNA replication, a double-stranded DNA molecule divides into two single strands. New nucleotides bond to each.
Principles of Evolution
Molecular Genetics Transcription & Translation
From DNA to Protein - Gene Expression: RNA and Protein
12.4 Assessment Answers.
Genomes and Their Evolution
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
UNIT 5 Protein Synthesis.
DNA Structure and Function
Introductory Pharmacology
A gene is a segment of DNA that holds the ‘directions’ for a certain physical trait such as eye color The ‘directions’ contained on a gene or genes tells.
Genetics: From Genes to Genomes
The Study of Biological Information
Noncoding RNA roles in Gene Expression
The Structure of the Genome
Presentation transcript:

55-213: Introductory Molecular Biology Professor : Dr. Andrew Hubberstey Office: Biology Building room please use CLEW site! Office Hours: Wednesdays 1-3 PM Starts January 15, 2014

Course Textbook: Text Book: Lewin Genes XI ( c 2014) Author: Krebs, Goldstein, Kilpatrick Publisher: Bartlett & Jones Lecture Notes: lecture notes for that week will be available on the web site at the end of that week of lectures lecture attendance is critical All figures in lecture will be taken from Genes XI. However, most are the same as in Genes X, so Genes X should be fine for this course.

Access code is NOT required for this course

Midterm: 30% of the final grade Tues. Feb. 11, 2014 Place: In class (additional rooms will be used) Final Exam: 45% of the final grade Thursday April 10th. 3:30PM Location:TBA Course Grading questions are multiple choice/short answer Lecture Assignment (5% total) instructions to be given in class going over mid-term exams will only be allowed for two weeks following the exam

Laboratories: 20% due to high students numbers, each lab will run on two successive weeks (Weeks A and B) therefore, students will be expected to come to lab every other week Labs start week of January 13 th sign up for lab weeks (A or B) will be done on CLEW site starting January 8 th at 5PM! go to sections in CLEW site have to be in the officially signed in section select either the week A or B section deadline is Friday, January 10th by midnight Coordinator : Janice Tubman

lab component worth 20% of final grade 10% lab final exam (held in class, April 3 rd ) 10% (quizzes and/or assignments- 1/week) Lab Marks: 5 labs/semester held in Biology building room 303 if you cannot make a lab, you have to contact Janice Tubman and arrange for an alternate time if possible

Section # Enrol DayTime 5150M2: M6: T8: T6: W2: W6: R6:30 Lab Sections *You have to sign up for a laboratory section!! Use the wait list to try to enroll in another section* Deadline for changing sections: Friday Jan. 10

Other course issues: university policy for students to only use their uwindsor account when contacting professors on course business and please use course web site for it is not permitted to post material from this class on other web sites please turn off cell phones prior to class starting using computers for anything other than notes or course work during lectures is prohibited

What I would like you to get out of this course: understanding of how your genome is organized and functions how molecular biology processes function in your cells appreciation of how amazing these processes are and the impact new molecular biology technology will have on society why molecular biology is extremely important for your lives

Why is molecular biology important to your lives? molecular technology will revolutionize medicine in the next years and will affect everyone understanding how diseases are caused susceptibility genes for multigenic diseases (cancer, heart disease, schizophrenia, autism) everyone will have their own genome sequence in the next decade

How much DNA does each of your cells contain? GACGTCTGCGTGGTCAGACT GTGCCCACATGGGGCCCGGG ACACCCAACTGCCGCCTGCT CTACTCATACCTCAATGATA GGCAGCGCCACGGGCTGGCC 1 metre- 3 billion nucleotides 57 years! Your Genome: How long would it take to read your genome?

Human Genome project: completed April, 2003 entire nucleotide sequence of our chromosomes 20-25,000 genes cost about $3 billion Human genome: Quality assessment of the human genome sequence.genome sequence. Nature 429, (27 May 2004)

Personalized medicine: Your individual genome sequence ~$100 within 3-5 years determine susceptibility to disease which medications you will respond to or react to: will be used in doctor’s offices in next 10 years important to understand what this information means 32,000 deaths/year due to adverse side effects of prescription drugs

What can you get today for $99? Not complete genomic sequence Sequences of thousands of genetic markers, >1,000,000 base pairs (Anne Wojcicki and Linda Avey)

Using genomic information for disease discovery, treatment and drug effectiveness (pharmacogenomics) Personalized medicine:

Ethical questions: What to do with this information without treatment for some diseases? Psychological impacts on individuals and their disease risks Impacts on insurance policies and job security

How many of your own cells in your body? trillion How many total cells in/on your body? 150 trillion Other genome projects Human Microbiome Project

Bacterial diversity on the human body 71%2Fjournal.pone Very few bacterial species can be cultured in lab (<10%) New DNA sequencing technologies can now identify many unknown bacterial species without culturing

Genomes and Evolution some genes have been mutated or duplicated 2.7% of genomes are different FoxP2: differs by two amino acids involved in speech development

How do our cells respond to environmental signals? Molecular signals:

C0h8xYw

Fig 1.1 History of Molecular Biology

Other genomes sequenced

What is a gene? What is an allele? What is transcription? What is translation? What is a single nucleotide polymorphism? 5 questions

Fig 1.19 DNA polymerase dsDNA DNA replication: RNA polymerase dsDNA ssRNA Transcription: Reverse Transcription: Reverse transcriptase ssRNA dsDNA

What is the definition of a gene??? sequence of DNA that encodes a functional RNA molecule; In protein coding genes, the RNA in turn codes for protein some genes encode RNA that is not translated into protein e.g.??Ribosomal RNA (rRNA) Transfer RNA (tRNA) Micro RNAs (miRNA nucl.) much more numerous than first thought- play roles in regulating gene expression PIWI RNAs (piRNA nucl.) Small inhibitory RNAS (siRNA)