1 Nucleic Acids

2 Structure of DNA  made of monomers called nucleotides  nucleotides composed of a phosphate, deoxyribose sugar, and a nitrogen-containing base  The 4 bases in DNA are: adenine (A), thymine (T), guanine (G), and cytosine (C)

3 DNA Nucleotide

4 Base Pairing Rule A (adenine) pairs with T (thymine)A (adenine) pairs with T (thymine) C (cytosine) pairs with G (guanine)C (cytosine) pairs with G (guanine)

5 Nitrogen Rings Purines have double rings =(G, A)Purines have double rings =(G, A) Pyrimidines have single rings =(C, T)Pyrimidines have single rings =(C, T) complementary base pairing = purine always paired with pyrimidinecomplementary base pairing = purine always paired with pyrimidine

6 Anti- Parallel Strands of DNA

7 DNA Replication

8 Steps in DNA Replication chromosomes duplicate (make copies) Hydrogen bonds break and enzymes “unzip” the molecule by enzyme DNA helicase old strand serves as a template New nucleotides move into complementary positions New nucleotides move into complementary positions joined by DNA polymerase joined by DNA polymerase

9 Two New, Identical DNA Strands Result from Replication

10 Another View of Replication

11 RNA

12 RNA Differs from DNA 1.RNA has a sugar ribose DNA has a sugar deoxyribose 2.RNA contains the base uracil (U) DNA has thymine (T) 3.RNA molecule is single-stranded DNA is double-stranded

13 Structure of RNA

14. Three Types of RNA Messenger RNA (mRNA) carries genetic information to ribosomesMessenger RNA (mRNA) carries genetic information to ribosomes Ribosomal RNA (rRNA), makes up the ribosomesRibosomal RNA (rRNA), makes up the ribosomes Transfer RNA (tRNA) transfers amino acids to the ribosomesTransfer RNA (tRNA) transfers amino acids to the ribosomes

15 Transcription Translation

16 Overview of Transcription  transcription in the nucleus, segment of DNA unwinds and unzips, and the DNA serves as a template for mRNA formation  RNA polymerase joins the RNA nucleotides so that the codons in mRNA are complementary to the triplet code in DNA

17 Transcription

18

19 DNApre-mRNA RNA Polymerase

20 Question:  What would be the complementary RNA strand for the following DNA sequence? DNA 5’-GCGTATG-3’

21 Answer: DNA 5’-GCGTATG-3’DNA 5’-GCGTATG-3’ RNA 3’-CGCAUAC-5’RNA 3’-CGCAUAC-5’

22 Messenger RNA (mRNA) Carries info for a specific proteinCarries info for a specific protein Sequence of 3 bases called codonSequence of 3 bases called codon AUG – methionine or start codonAUG – methionine or start codon UAA, UAG, or UGA – stop codonsUAA, UAG, or UGA – stop codons

23 Messenger RNA (mRNA) methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon Primary structure of a protein aa1 aa2aa3aa4aa5aa6 peptide bonds codon 2codon 3codon 4codon 5codon 6codon 7codon 1

24 Transfer RNA (tRNA) 75 to 80 nucleotides long75 to 80 nucleotides long Picks up the amino acid, transports amino acids to the mRNAPicks up the amino acid, transports amino acids to the mRNA anticodons are complementary to mRNA codonsanticodons are complementary to mRNA codons

25 Transfer RNA (tRNA) amino acid attachment site UAC anticodon methionine amino acid

26 Ribosomal RNA (rRNA) Associates with proteins to form ribosomesAssociates with proteins to form ribosomes

27 PROTEIN SYNTHESIS

28

29

30 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation  mRNA must be processed before it leaves the nucleus of eukaryotic cells

31 DNA  RNA  Protein Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell

32 Pathway to Making a Protein DNAmRNA tRNA (ribosomes) Protein

33 Making a Protein

34 Genes & Proteins  Proteins are made of amino acids linked together by peptide bonds  20 different amino acids  Amino acids chains = polypeptides  Segment of DNA that codes for the amino acid = genes

35 Two Parts of Protein Synthesis  Transcription makes an RNA from DNA  Translation = mRNA used to make amino acids

36 Genetic Code  DNA contains triplet code  three bases of DNA = ONE amino acid  three-letter unit on mRNA = codon  Most amino acids have more than one codon!  20 amino acids ; possible 64 triplets  The code is universal

37

38 Translation Synthesis of proteins in the cytoplasmSynthesis of proteins in the cytoplasm Involves the following:Involves the following: 1.mRNA (codons) 2.tRNA (anticodons) 3.ribosomes 4.amino acids

39 Translation Three steps:Three steps: 1.initiation: start codon (AUG) 2.elongation: amino acids linked 3.termination: stop codon (UAG, UAA, or UGA). Let’s Make a Protein !

40 mRNA Codons Join the Ribosome P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG

41 Initiation mRNA AUGCUACUUCG 2-tRNA G aa2 AU A 1-tRNA UAC aa1 anticodon hydrogen bonds codon

42 mRNA AUGCUACUUCG 1-tRNA2-tRNA UACG aa1 aa2 AU A anticodon hydrogen bonds codon peptide bond 3-tRNA GAA aa3 Elongation

43 mRNA ACAUGU aa1 aa2 U primarystructure of a protein aa3 200-tRNA aa4 UAG aa5 CU aa200 aa199 terminator or stop or stop codon codon Termination

44 End Product –The Protein! The end products of protein synthesis is a primary structure of a proteinThe end products of protein synthesis is a primary structure of a protein A sequence of amino acid bonded together by peptide bondsA sequence of amino acid bonded together by peptide bonds aa1 aa2 aa3 aa4 aa5 aa200 aa199