RNA AND PROTEIN SYNTHESIS. Central Dogma of Biology! Genes are codes for making polypeptides (proteins) The nitrogenous bases (ATCG’s) contain the code!

Slides:



Advertisements
Similar presentations
RNA AND PROTEIN SYNTHESIS
Advertisements

copyright cmassengale
Dr. Maha Daghestani DNA structure and function Dr. Maha Daghestani November 2007.
PROTEIN SYNTHESIS Higher Level Learning Outcomes At the end of this topic you should be able to 1. Outline the steps in protein synthesis 2.Know that.
PROTEIN SYNTHESIS.
PROTEIN SYNTHESIS.
Nucleic Acids.
RNA.
Protein Synthesis The production (synthesis) of polypeptide chains (proteins) Two phases: Transcription & Translation mRNA must be processed before it.
 2 phases  2 phases : 1.Transcription 2.Translation  DNA  RNA  Protein.
Protein Synthesis Human Biology. DNA Deoxyribonucleic Acid Twisted ladder or double helix Nucleotides Composed of alternating sugar (Deoxyribose) and.
Structure & concept of gene, One gene one enzyme hypothesis, Genetic Code PROTEIN SYNTHESIS, Regulation of gene expression Dr. Madhumita Bhattacharjee.
copyright cmassengale
PROTEIN SYNTHESIS. DNA and Genes DNA DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used.
DNA mRNA Protein.  Every living thing is made up of cells.  There are differences between different types of cells, but they’re made of the same building.
1 PROTEIN SYNTHESIS. 2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation.
1 PROTEIN SYNTHESIS. 2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation.
1 PROTEIN SYNTHESIS. 2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation  mRNA.
Transcription & Translation Transcription DNA is used to make a single strand of RNA that is complementary to the DNA base pairs. The enzyme used is.
Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message.
Hooray! First, a Video!. 2 Nucleic Acids 3 DNA!  Frederick Griffith in 1928 showed the DNA was the cell’s genetic material  Watson & Crick in the 1950’s.
PROTEIN SYNTHESIS.
RNA and Protein Synthesis. Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by copying part of.
PROTEIN SYNTHESIS.
1 PROTEIN SYNTHESIS: Translation. 2 Transcription Translation DNA mRNA Ribosome Protein Prokaryotic Cell DNA  RNA  Protein.
RNA AND PROTEIN SYNTHESIS
1 DNA, RNA, and PROTEIN SYNTHESIS. 2 Transcription Translation DNA mRNA Ribosome Protein Prokaryotic Cell DNA  RNA  Protein.
Gene Expression. Central Dogma Information flows from: DNA  RNA  Protein Exception: reverse transcriptase (retroviruses) RNA  DNA  RNA  Protein.
1 PROTEIN SYNTHESIS. DNA and Genes DNA DNA contains genes, sequences of nucleotide bases These Genes code for proteins Proteins are used to build cells.
1 PROTEIN SYNTHESIS copyright cmassengale. DNA and Genes 2copyright cmassengale.
PROTEIN SYNTHESIS PROTEIN SYNTHESIS Section 12.3.
1 DNA  RNA  Protein DNA  mRNA  Protein Nuclear membrane Transcription Translation DNA mRNA Ribosome Protein Eukaryotic Cell.
PROTEIN SYNTHESIS 1. DNA AND GENES DNA ■ DNA contains genes, sequences of nucleotide bases ■ Genes have different alleles. ■ These genes code for polypeptides.
DNA Structure & Replication DNA DNA.DNA is often called the blueprint of life. In simple terms, DNA contains the instructions for making proteins.
Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis - a cell makes protein based on the message contained within its DNA.
Protein Synthesis: Making Those Proteins!. Review: DNA Hershey and Chase’s experiment showed that DNA was the genetic material.
copyright cmassengale
PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.
PROTEIN SYNTHESIS. DNA and Genes DNA DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used.
Protein Synthesis Making Proteins from DNA. DNA & the Nucleus DNA cannot leave the nucleus! So how can we get the information for making proteins out.
1 The Central Dogma of Biology PROTEIN SYNTHESIS.
Transcription and Translation Chapter 21. Objectives Summarize how genetic information is encoded in DNA, how it provides instructions for making proteins.
PROTEIN SYNTHESIS. Review: DNA contains genes or a set of instructions. These genes code for a certain sequence of amino acids, that form polypeptides,
1. Transcription and Translation 2copyright cmassengale.
1 Nucleic Acids 2 Structure of DNA  made of monomers called nucleotides  nucleotides composed of a phosphate, deoxyribose sugar, and a nitrogen-containing.
RNA AND PROTEIN SYNTHESIS. How your cell makes very important proteins proteinsThe production (synthesis) of proteins. 2 phases2 phases: 1.Transcription.
DNA replication and Protein synthesis.. DNA (Deoxyribonucleic Acid)
1copyright cmassengale. RNA 2 3 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan copyright cmassengale.
1 PROTEIN SYNTHESIS. 2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation  mRNA.
copyright cmassengale
What is gene expression? Gene Expression and Protein Synthesis The Genetic Code Gene-a section of DNA that codes for an amino acid sequence.
Protein Synthesis.
RNA AND PROTEIN SYNTHESIS
RNA AND PROTEIN SYNTHESIS
PROTEIN SYNTHESIS.
PROTEIN SYNTHESIS.
copyright cmassengale
copyright cmassengale
RNA AND PROTEIN SYNTHESIS How does protein synthesis occur?
GENE EXPRESSION / PROTEIN SYNTHESIS
RNA AND PROTEIN SYNTHESIS
RNA AND PROTEIN SYNTHESIS How does protein synthesis occur?
RNA AND PROTEIN SYNTHESIS
The Central Dogma … From DNA to proteins.
PROTEIN SYNTHESIS.
Protein Synthesis.
Protein Synthesis.
Protein Synthesis.
Presentation transcript:

RNA AND PROTEIN SYNTHESIS

Central Dogma of Biology! Genes are codes for making polypeptides (proteins) The nitrogenous bases (ATCG’s) contain the code! DNA is stored in the nucleus and proteins are made in the cytoplasm

How your cell makes very important proteins 1.Transcription – copy of the code 2. Translation – translation into proteins DNA  RNA  ProteinDNA  RNA  Protein Such as…. Insulin, testosterone, human growth hormone, amylase, serotonin, melatonin, melanin, dystrophin, platlets etc.…...

Before making proteins, Your cell must first make RNA Question:Question: RNA(ribonucleic acid) DNA (deoxyribonucleic acid)How does RNA (ribonucleic acid) differ from DNA (deoxyribonucleic acid)?

RNADNA RNA differs from DNA RNAsugar ribose 1.RNA has a sugar ribose DNAsugar deoxyribose DNA has a sugar deoxyribose RNAuracil (U) 2.RNA contains uracil (U) DNAthymine (T) DNA has thymine (T) RNAsingle-stranded 3.RNA molecule is single-stranded DNAdouble-stranded DNA is double-stranded

1. Transcription OR RNA production RNA molecules are produced by copying part of DNA into a complementary sequence of mRNA This process is started and controlled by an enzyme called Helicase – “unzips” the double stranded DNA.

1. Transcription DNA mRNA (messenger RNA) Helicase Helicase opens the DNA and DNA polymerase Adds base pairs to the mRNA strand. (copy of the DNA)

Question: RNADNAWhat would be the complementary RNA strand for the following DNA sequence? Remember U replaces T DNA 5’-GCGTATG-3’DNA 5’-GCGTATG-3’

Types of RNA Three types ofRNAThree types of RNA: A.messenger RNA (mRNA) B.transfer RNA (tRNA) C.ribosome RNA (rRNA)

mRNA Carries instructions from DNA to the rest of the ribosome. Tells the ribosome what kind of protein to make Acts like an from the principal to the cafeteria lady.

A. Messenger RNA (mRNA) methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon Primary structure of a protein aa1 aa2aa3aa4aa5aa6 peptide bonds codon 2codon 3codon 4codon 5codon 6codon 7codon 1 Bases are read as three letter codons

rRNA Part of the structure of a ribosome Location in the cytoplasm where translation occurs Helps in protein production tRNA Gets the right amino acids to make the right Protein according to mRNA copy of instructions

B. Transfer RNA (tRNA) methionine

Ribosomes P Site A Site Large subunit Small subunit mRNA

2. RNA Processing pre-RNA molecule intron exon Mature RNA molecule exon intron splicesome

3. Translation Three parts: initiation 1.initiation: start codon (AUG) - Primer elongation 2.elongation: codon is read and amino acid attached. termination 3.termination: stop codon (UAG) Watch a PROTEIN being made!!!!!Watch a PROTEIN being made!!!!!

3. Translation P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG

Initiation mRNA AUGCUACUUCG 2-tRNA G aa2 AU A 1-tRNA UAC HIS HIS Tyr anticodon hydrogen bonds codon

mRNA AUGCUACUUCG 1-tRNA2-tRNA UACG HIS Asp AU A anticodon hydrogen bonds codon peptide bond 3-tRNA GAA aa3 Elongation

mRNA AUGCUACUUCG 1-tRNA 2-tRNA UAC G Tyr Asp AU A peptide bond 3-tRNA GAA aa3 Ribosomes move over one codon (leaves)

mRNA AUGCUACUUCG 2-tRNA G Tyr Asp AU A peptide bonds 3-tRNA GAA Glu 4-tRNA GCU Ala ACU

mRNA AUGCUACUUCG 2-tRNA G Tyr Asp AU A peptide bonds 3-tRNA GAA Glu 4-tRNA GCU Ala ACU (leaves) Ribosomes move over one codon

mRNA GCUACUUCG Tyr Asp A peptide bonds 3-tRNA GAA Glu 4-tRNA GCU Ala ACU UGA 5-tRNA Stop

mRNA GCUACUUCG Tyr Asp A peptide bonds 3-tRNA GAA Glu 4-tRNA GCU Ala ACU UGA 5-tRNA Stop Ribosomes move over one codon

mRNA ACAUGU His Asp U primarystructure of a protein Glu 200-tRNA Ala UAG Stop CU terminator or stop or stop codon codon Termination

End Product primary structure of a proteinThe end products of protein synthesis is a primary structure of a protein. amino acid peptide bondsA sequence of amino acid bonded together by peptide bonds. Tyr Asp Glu Ala Stop

Question: The anticodon UAC belongs to a tRNA that recognizes and binds to a particular amino acid.The anticodon UAC belongs to a tRNA that recognizes and binds to a particular amino acid. What would be the DNA base code for this amino acid?What would be the DNA base code for this amino acid?

Answer: tRNA - UAC (anticodon)tRNA - UAC (anticodon) mRNA- AUG (codon)mRNA- AUG (codon) DNA - TACDNA - TAC

Mutations changing of the structure of a gene, resulting in a variant form that may be transmitted to subsequent generations, caused by the alteration of single base units in DNA Types: deletion, insertion, substitution, repeats, rearrangement

Feedback: Privacy Policy Feedback
Do Not Sell My Personal Information
About project: SlidePlayer Terms of Service

© 2025 SlidePlayer.com. Inc. All rights reserved.