200 300 400 500 100 200 300 400 500 100 200 300 400 500 100 200 300 400 500 100 200 300 400 500 100 Proteins Transcription ProcessingTranslationViruses.

Slides:

Advertisements

Similar presentations

Protein Synthesis $100 $200 $300 $400 $500 $100$100$100 $200 $300 $400 $500 Central Dogma Basics Transcription RNA Mutations FINAL ROUND Translation.

Advertisements

RNA and Protein Synthesis

Transcription & Translation Biology 6(C). Learning Objectives Describe how DNA is used to make protein Explain process of transcription Explain process.

RNA and Protein Synthesis

Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 3 Cell Structures and Their Functions Dividing Cells.

10-2: RNA and 10-3: Protein Synthesis

What organic molecule is DNA? Nucleic Acid. An organic molecule containing hydrogen, oxygen, nitrogen, carbon, and phosphorus Examples: DNA ???? RNA.

DNA Biology Lab 11. Nucleic Acids  DNA and RNA both built of nucleotides containing Sugar (deoxyribose or ribose) Nitrogenous base (ATCG or AUCG) Phosphate.

11.2. Remember…. Nucleic Acid – one of the BIG FOUR DNA – Deoxyribonucleic Acid Directions for building proteins Nucleotides are building blocks Sugar-

Chapter 11 DNA and Genes. Proteins Form structures and control chemical reactions in cells. Polymers of amino acids. Coded for by specific sequences of.

13.1/13.2 Protein Synthesis From DNA to Protein Protein Synthesis is the process that cells use to produce - it involves.

DNA StructureDNA Structure  DNA is composed of a chain of nucleotides.

Transcription and Translation

Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.

VII RNA and Protein Synthesis

Chapter 13.1 and 13.2 RNA, Ribosomes, and Protein Synthesis

RNA & Protein Synthesis.

Protein Synthesis-How do we go from genotype to phenotype.

Protein Synthesis Involves RNA (base change of uracil for thyamine, single small strand and less stable than DNA). Three types of RNA – messenger (mRNA),

From Gene To Protein Chapter 17. From Gene to Protein The “Central Dogma of Molecular Biology” is DNA  RNA  protein Meaning that our DNA codes our RNA.

RNA and Protein Synthesis

The big picture………

12-3 RNA and Protein Synthesis

 Translation Creating Protein from mRNA Protein Structure  Proteins are made of Amino Acids.  There are 20 different Amino Acids.  The sequence of.

Protein Synthesis The process of putting together amino acids to form proteins in the cell. The process of putting together amino acids to form proteins.

RNA (ribonucleic acid) – single stranded nucleotide chain – ribose sugar – G-C and A-U – Uracil instead of Thymine – Different types: – mRNA, tRNA, rRNA.

12-3 RNA AND PROTEIN SYNTHESIS. 1. THE STRUCTURE OF RNA.

Section 12-3 RNA & Protein Synthesis

 Watch these 2 animations and try to explain what is going on.  Animation 1 Animation 1  Animation 2 Animation 2.

Notes for DNA & RNA. DNARNA Double stranded Single stranded Uses the base T Uses the base U Sugar is deoxyribose Sugar is ribose.

Compared to DNA and Types

DNA to Protein The processes of DNA transcription and translation.

RNA By PresenterMedia.com PresenterMedia.com. DNA is located in the nucleus of eukaryotic cells A strand of DNA is moved from the nucleus out into the.

DNA in the Cell Stored in Number of Chromosomes (24 in Human Genome) Tightly coiled threads of DNA and Associated Proteins: Chromatin 3 billion bp in Human.

DNA, RNA, and Protein Synthesis. Function of DNA as “master” program DNA codes for the primary structure of a protein which impacts the tertiary structure,

RNA (ribonucleic acid)

Protein Synthesis. The DNA Code The order of bases along the DNA strand codes for the order in which amino acids are chemically joined together to form.

Protein Synthesis. Review…  DNA:  Found in the nucleus  Double stranded  Contains the instructions for controlling the cell (including instructions.

Chapter 12-3: RNA & Protein Synthesis Essential Questions:  What are 3 types of RNA?  What is the function of 3 types of RNA?  What happens during transcription?

Placed on the same page as your notes Warm-up pg. 48 Complete the complementary strand of DNA A T G A C G A C T Diagram 1 A T G A C G A C T T A A C T G.

RiboNucleic Acid (RNA) -Contrast RNA and DNA. -Explain the process of transcription. - Differentiate between the 3 main types of RNA -Differentiate between.

Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.

CH 12.3 RNA & Protein Synthesis. Genes are coded DNA instructions that control the production of proteins within the cell…

Protein Synthesis Chapter 9 p Protein Synthesis Gene- segment of DNA that codes for a protein. Gene Expression/ Protein Synthesis is the process.

Protein Synthesis Notes. Main Idea DNA codes for RNA, which guides protein synthesis. Protein Synthesis is the making of proteins.

12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.

End Show 12–3 RNA and Protein Synthesis Slide 1 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis 106. What are genes? They are coded.

DNA to Proteins: Transcription and Translation. Sickle Cell Anemia Video.

DNA to RNA to Protein. RNA Made up of 1. Phosphate 2. Ribose (a sugar) 3. Four bases RNA bases are: Adenine Guanine Cytosine Uracil (instead of thymine)

Chapter 13 From DNA to Proteins

RNA and Protein Synthesis

How to Make a Protein?.

Protein Synthesis.

Protein Synthesis.

Biology Unit 4 Notes: RNA & Protein Synthesis

Protein Synthesis Standards:

Protein Synthesis Genetics.

RNA and Protein Synthesis

Protein Synthesis in Detail

Transcription & Translation.

12-3 RNA and Protein Synthesis

Overview of Protein Synthesis And RNA Processing

Protein Synthesis Standards:

From Genes to Proteins.

Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.

12-3 RNA and Protein Synthesis

Compared to DNA and Types

From Genes to Proteins.

RNA, Protein Synthesis, Transcription, and Translation

DNA Replication Living Environment 2015.

Presentation transcript:

Proteins Transcription ProcessingTranslationViruses

The building blocks of proteins

Amino Acids

List 3 protein used by organisms

Cell structures, tissues, keratin, collagen, myosin

Protein used for communication

Hormones

Proteins that catalyze chemical reactions

enzymes

What does the enzyme lysozyme do?

Helps destroy harmful bacteria by cutting a polysaccharide found in bacterial cell walls

RNA synthesis

Transcription

Where transcription occurs in eukaryotes.

Nucleus

Three ways that RNA is different that DNA?

Uracil, ribose, single stranded, shorter

Which types of RNA are synthesized during transcription?

mRNA, tRNA, rRNA

Describe the 3 types of RNA

mRNA- copies DNA rRNA-makes up the ribosomes tRNA-transports the amino acids to the ribosomes.

Where does RNA processing occur?

nucleus

Why is the RNA after it leaves the nucleus shorter than after it was transcribed?

Processing edits

Parts that are edited out of the mRNA?

introns

Why is processing necessary?

To remove nonfunctional parts of the RNA

Explain RNA editing and splicing.

Snurps form the slicosome and create a lariat to excise the introns and maintain the exons.

Where does translation occur

ribosome

What is made in translation?

Proteins

The amino acid “code” is called __

codon

Amino acids are always coded from the __

mRNA

Explain translation

mRNA attaches to a 2 part ribosome, tRNA brings the amino acids to the A site where the codon and anticodon match the amno acid is transferred to the polypeptide chain at the P site, the tRNA exits at the E site.

Virus that infects bacteria

Bacteriophage

Most viruses consist of (2 things)

Protein coat and DNA or RNA

What is a virus that consists of RNA called?

retrovirus

Type of viral infection that produce new viruses

Lytic infection

Explain how lytic and lysogenic infections are different.

Lytic produces new viruses while lysogenic infections incorporates it’s DNA into the host cell’s DNA and the cell copies can become lytic.