Transcription & Translation It’s all about making...

Slides:

Advertisements

Similar presentations

3 Types of RNA.

Advertisements

From DNA to Protein Section 11.2 Pg

PROTEIN SYNTHESIS.

8.4 DNA Transcription 8.5 Translation

The Structure of RNA RiboNucleic Acid

How does DNA work? Building the Proteins that your body needs.

RNA carries DNA’s instructions.

Protein Synthesis The production (synthesis) of polypeptide chains (proteins) Two phases: Transcription & Translation mRNA must be processed before it.

Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis

RNA Ribonucleic acid single stranded also made of nucleotides.

DNA StructureDNA Structure  DNA is composed of a chain of nucleotides.

1. RNA vs. DNA RNADNA TThe sugar is RIBOSE UURACIL (U) is substituted for (T) Thymine AA=U CC=G RRNA is a single stranded chain of nucleotides.

Transcription and Translation

Transcription and Translation

Protein Synthesis Chapter 13. Protein Synthesis  How does your DNA eventually lead to your different phenotypes (hair color, eye color, etc)

Protein Synthesis Transcription and Translation DNA Transcription RNA Translation Protein.

Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.

RNA and protein synthesis. RNA Single strand of nucleotides Sugar is ribose Uracil instead of thymine.

DNA to Proteins 3-4.

DNA, RNA and Protein Synthesis. In eukaryotes, genetic information is stored in which organelle? nucleus.

Chapter 12 Making Proteins. Differences between RNA and DNA DNA = double strand; RNA = single strand RNA contains Ribose instead of deoxyribose. RNA uses.

SC.912.L.16.5 Protein Synthesis: Transcription and Translation.

Protein Synthesis 1 Background Information All information is stored in DNA All information is stored in DNA RNA “reads” the DNA code RNA “reads” the.

Central Dogma DNA  RNA  Protein. …..Which leads to  Traits.

Protein Synthesis Transcription. DNA vs. RNA Single stranded Ribose sugar Uracil Anywhere Double stranded Deoxyribose sugar Thymine Nucleus.

RNA and Protein Synthesis

Protein Synthesis Process that makes proteins

Transcription & Translation Transcription DNA is used to make a single strand of RNA that is complementary to the DNA base pairs. The enzyme used is.

12-3 RNA and Protein Synthesis

DNA replication DNA makes a copy of itself BEFORE the cell divides Transcription RNA is made by base pairing with a DNA template Translation mRNA templates.

Protein Synthesis What is protein synthesis? Is protein synthesis important? What is RNA? Where is RNA found? Is RNA similar to DNA? What is translation?

12-3 RNA AND PROTEIN SYNTHESIS. 1. THE STRUCTURE OF RNA.

Do Now: Define genotype and phenotype. Then determine the relationship between the two.

DNA Transcription & Protein Translation. Today’s Objectives Introduce Protein Synthesis Compare types of nucleic acid.

DNA Transcription & Protein Translation. DNA Transcription DNA must be copied to messenger RNA (mRNA) in the nucleus mRNA travels from nucleus to the.

DNA to Protein The processes of DNA transcription and translation.

DNA & Protein Synthesis. Vocabulary terms to learn: gene messenger RNA (mRNA) ribosomal RNA (rRNA) transfer RNA (tRNA) transcription RNA polymerase codon.

RNA & Protein Synthesis Ribose RNA. DNARNA StructureDouble Stranded Single Stranded Bases- PurinesAdenine (A) Guanine (G) Bases - Pyrimidines Cytosine.

Protein Synthesis: Transcription & Translation.

DNA Replication Review Three main steps: Helicase unzips/unwinds the DNA molecule DNA Polymerase brings in new nucleotides Ligase zips the new DNA back.

Protein Synthesis How genes work.

Translation and Protein Synthesis Notes

Protein Synthesis. Review…  DNA:  Found in the nucleus  Double stranded  Contains the instructions for controlling the cell (including instructions.

Making of Proteins. DNA Replication DNA molecule produces two new complementary strands. Each strand of the double helix of DNA serves as a template for.

8.4 Transcription KEY CONCEPT Transcription converts a gene into a single-stranded RNA molecule.

Protein Synthesis Making Proteins from DNA. DNA & the Nucleus DNA cannot leave the nucleus! So how can we get the information for making proteins out.

8.3 DNA Replication KEY CONCEPT DNA replication copies the genetic information of a cell.

DNA-RNA-Protein The Central Dogma. Transcription-1 DNA can’t leave the nucleus. Proteins are made in the cytoplasm. What a conundrum!

12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.

Chapter 12.3 DNA, RNA and Protein DNA, RNA, and Protein Molecular Genetics Central Dogma  RNA - Contains the sugar ribose and the base uracil,

Protein Synthesis The Making of Proteins Using the Genetic Information Stored in DNA.

DNA Transcription and Translation Review. There are 3 types of RNA: Messenger RNA (mRNA) Ribosomal RNA (rRNA) Transfer RNA (tRNA)

Notes: Transcription DNA vs. RNA

RNA and Protein Synthesis

PROTEIN SYNTHESIS.

Protein Synthesis.

PROTEIN SYNTHESIS CHAPTER 10 section 4

Chp: 12 Transcription & Translation

Transcription & Translation.

Transcription and Translation

Transcription and Translation

Analyze the process of DNA replication.

Nucleic Acids: RNA Ribonucleic Acid: RNA

Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.

Transcription & Translation

RNA - TRANSLATION.

Transcription/ Translation Notes 16-17

GENE EXPRESSION / PROTEIN SYNTHESIS

Transcription Using DNA to make RNA.

12-3 RNA & Protein Synthesis

Presentation transcript:

Transcription & Translation

It’s all about making...

Here is an... DNA not only stores information, but accurately passes it on through replication & RNA transcription.

DNA unwinds and unzips (Helicase). RNA Polymerase binds to and moves along a DNA strand. RNA nucleotides are joined in order complimentary to the DNA nucleotide sequence. Coding Strand Helicase & RNA polymerase Helicase & RNA polymerase

A nice image of the same thing! mRNA Nucleotides Helicase & Helicase &

There are three kinds of... 1) mRNA (Messenger) 2) rRNA (Ribosomal) 3) tRNA (Transfer)

Messenger RNA (mRNA) carries the DNA message out of the nucleus and into the cytoplasm to ribosomes, the site of protein synthesis. Single strand complementary to the template strand.

Transfer RNA (tRNA) leaves the nucleus, binds to the amino acid specified by it’s anticodon and transfers it to the ribisome where it meets up with mRNA to assemble a protein. Single strand complementary to the coding strand. tRNA UACGGCAAUCUGGCAAUCGCCUGGACUG tRNA

Processing results in a “T” shape, with an amino acid binding site at one end and an anticodon at the other.

Ribosomal RNA (rRNA) is RNA in globular form. It joins with 83 proteins to form a ribosome. The sites labeled “P” and “A” bind tRNA. The “groove” formed between the two subunits is the site of mRNA binding.

AKA

Here is an... DNA not only stores information, but accurately passes it on through replication & RNA transcription.

Here’s where it all comes together!!! Here’s where it all comes together!!! mRNA, carrying the codon and tRNA, carrying the anticodon, meet at the ribosome (rRNA) to piece together amino acids.

Ribosome rRNA + Protiens Ribosome rRNA + Protiens Here’s how it works...

Here it is all together!

A nice image of the same thing! Codon Anticodon

The result... This is a representation of one molecule of hemoglobin. It is the result of amino acids strung together into peptides, joined to form polypeptides which combine to make up the final protein.

A nice image of a protein being made! Codon Anticodon

How about a review?