Genetic Changes: Mutations Chapter 11.3. I. MUTATION  ANY change in an organisms DNA sequence  Causes  Errors in replication  Transcription  Cell.

Slides:

Advertisements

Similar presentations

Mutations. General Definition Long Notes: Any change in DNA sequence is called a mutation. Abbreviated Notes (AN): Mutation (mut) = DNA sequence (seq)

Advertisements

1.Using the table on Pg. 292, write the amino acid sequence that would be made according to the codons on the mRNA chain. 2.Why do you think this exact.

 Mutation – any change in DNA sequence  Can be caused by errors inside the cell ◦ Errors in  Replication  Transcription  Cell division (mitosis,

Chapter 11 DNA Within the structure of DNA is the information for life- the complete instructions for manufacturing all the proteins for an organism. DNA.

MONSTROUS MUTATIONS!!!. What is a mutation? Mutations are changes in DNA! However, these simple changes or mistakes can cause big changes in phenotypes.

Chapter 8 DNA and GENES Biology Notes.

Chapter 11.3 Genetic Changes.

Section 11.3 MUTATIONS Section 11.3 pgs

C11- DNA and Genes Chapter 11.

Mutations Chapter 12.4.

Genetic Changes 11.3.

Mutations Genetic Changes.

Genetic Mutations Increasing Genetic Diversity May 4, 2010.

Ch Mutations Section Objectives:

Review: DNA, Transcription & Translation

Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads!... What do we have?

Section 11.3 Genetic Changes.

1 NOTES: MUTATIONS 2 MUTATIONS: MUTATIONS = changes in the DNA sequence that affect genetic information.

MUTATIONS I. VOCABULARY A. Mutation- Any change in the __________ sequence. 1. Mutations in body cells may cause _______ to be made wrong or not.

Chapter 11.6 Mutations. Definition- Mutation- a change in the DNA nucleotide sequence Mutation- a change in the DNA nucleotide sequence Types of mutations:

  Understand what mutations are  Understand how they occur  Analyze the different types of mutations  Understand how mutations affect amino acid.

MUTATIONS & HUMAN GENETICS Chapter 11.3, Chapter 12.

Chapter 10: DNA, RNA, and Protein Synthesis. Objectives: Analyze and investigate emerging scientific issues (e.g., genetically modified food, stem cell.

Sometimes replication, transcription and translation don’t go as planned! Replication, Transcription, and Translation errors result in mutations. A mutation.

DNA Mutations. What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA? CACGTGGACTGAGGACACCTC.

Mutations that happen during Transcription and Translation

DNA (Gene) Mutations. What is a gene mutation? Often times, parts of DNA will have a base (or more) missing, added, or incorrect.

DNA: the Molecule of Heredity. DNA DNA is a long molecule made of repeating subunits called nucleotides Nucleotides have three parts sugar phosphate and.

MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.

Mutations. Mutation effects Reproductive Cells -mutation in DNA sequence of an egg or sperm cell -mutation is passed on to offspring - possible effects.

MUTATIONS. Mutant An organism expressing a mutated gene.

12.4 Mutations Copyright Pearson Prentice Hall.. What Are Mutations? Changes in the nucleotide sequence of DNA (genetic material) May occur in somatic.

DNA (Deoxyribonucleic acid) Instructions for life Makes proteins/enzymes DNA Structure Polymer: Nucleotide subunits Nucleotides have 3 parts Sugar (deoxyribose)

MUTATIONS  Several things can go wrong when DNA replicates.  Mutations.

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcriptiontranslation.

Mutation Notes: Chapter 11.

Section 11.3: Genetic Changes

12.4 Assessment Answers.

Mutation Notes Chapter 12-4.

11.3 Mutations.

A change in the DNA sequence that affects genetic information

Gene Mutations A change in the DNA of a gene is called a mutation. Mutations in gametes can be passed on to the offspring of the affected individual,

Mermaid Syndrome Video.

Copyright Pearson Prentice Hall

What happens when things go wrong?

Bell Ringer: 11/21/17 Objective: Explain that mutations occur during DNA replication or transcription and may be random or a result of environmental agents.

What are Mutations? Are Mutations good or bad?

A change in the DNA sequence that affects genetic information

Mutations LN #23 Ms. Garcia California Content Standard Genetics

11.3 Section Objectives – page 296

Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads! What do we.

Mutations Section 12-4.

4c. Know how mutations in the DNA sequence of a gene may or may not affect the expression of the gene or the sequence of amino acids in the encoded proteins.

A mutation is a change in an organism’s DNA.

Gene and Chromosomal Mutations

11.3 Section Objectives – page 296

What is a MUTATION? Notes.

Presentation transcript:

Genetic Changes: Mutations Chapter 11.3

I. MUTATION  ANY change in an organisms DNA sequence  Causes  Errors in replication  Transcription  Cell division  External “mutagens”

A. Mutations in Reproductive Cells  Reproductive Cells  Gametes  Sperm  Egg  Only mutations in sex cells are passed on to offspring  Some mutations bad, some good

B. Mutations in Body Cells  NOT PASSED ON to offspring  Skin, muscle, or bone  Cells created from effected cell will also have same mutation  CANCER and growth of tumors

Cancer and Mutations

Brain Cancer Cells

Cancer Cell Undergoing Mitosis

C. The Effects of Point Mutations  Point mutations  Change in a single base pair in DNA  Only affects one amino acid in protein chain

D. Frameshift Mutations  Addition or deletion of a nitrogen base pair  Affects several amino acids in the protein sequence  Much greater effect as a mutation

II. CHROMOSOMAL MUTATIONS  When chromosomes break apart and recombine  Usually happens during DNA replication or cell division

III. CAUSES OF MUATIONS  MUTAGENS  Radiation  Chemicals  High temperatures  X-rays  Ultraviolet light (UV light): Cancer  Asbestos (was banned)