Mutations. I. Mutations -any change in DNA sequence (order of nucleotides) is a mutation. -mutations can occurr during DNA replication, transcription,

Slides:

Advertisements

Similar presentations

Mutations. A. Introduction to Mutations -A mutation is a change in DNA sequence (order of nucleotides). -Mutations are important because they increase.

Advertisements

Do Now Check, in your notes Replicate this DNA strand: CATCGG Transcribe this DNA strand in to RNA: CATAGG Write 3 differences between DNA and RNA.

1.Using the table on Pg. 292, write the amino acid sequence that would be made according to the codons on the mRNA chain. 2.Why do you think this exact.

 Mutation – any change in DNA sequence  Can be caused by errors inside the cell ◦ Errors in  Replication  Transcription  Cell division (mitosis,

Question #1 DNA and RNA nucleotides differ in their ___. Write in ALL that apply. a) Phosphate groups b) Nitrogenous bases c) Sugars d) Functions.

To demonstrate understanding, after this lesson, you should be able to  define mutations  explain how mutations occur when – DNA Replication or Meiosis.

Mutations in DNA. Mutations A mutation is a change in a DNA sequence. Can happen if – There is a mistake in replication. – Bases change spontaneously.

DNA, RNA, and Proteins By Liz LaRosa

Mutations. Mutation  Permanent changes or errors in a DNA sequence  Copied during DNA replication  Therefore heritable  OR may occur during transcription.

Ch Mutations Section Objectives:

Gene Mutations Chapter 11.

13-3 Mutations Can be good, bad or nothing!!. What is a mutation? The word is Latin for “to change”. There are 2 types: – 1) Single gene changes – 2)

  Understand what mutations are  Understand how they occur  Analyze the different types of mutations  Understand how mutations affect amino acid.

Mutations Learning Goal: Identify mutations in DNA (point mutation and frameshift mutation caused by insertion or deletion) and explain how they can affect.

Point Mutations Silent Missense Nonsense Frameshift.

Welcome to Genetic Mutations! 7x2WSY 7x2WSY.

Chromosomes and Genes Each chromosome has hundreds or thousands of genes. Each gene codes for a particular protein.

 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.

MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.

Genetic Changes: Mutations Chapter I. MUTATION  ANY change in an organisms DNA sequence  Causes  Errors in replication  Transcription  Cell.

DNA Mutations. Remember that during DNA replication, the DNA makes an exact copy of itself before it divides. DNA replication is not always accurate.

Wednesday, January 16 th What is a mutation? Reminders: DNA Test Friday.

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcriptiontranslation.

Genetic Errors & Mutations. DNA Sequence: TAC – AAG – CTG – CAT – ATT RNA Sequence: AUG – UUC – GAC – GUA – UAA Amino Acid Sequence: Met – Phenylalanine.

Mutations Announcement Quiz over Mutations on Monday! Test Wednesday!!! All genetics lessons.

Mutation Notes: Chapter 11.

DNA/GENE MUTATIONS.

BIOLOGY 12 Mutations.

Gene Mutations.

11.3 Mutations.

Introduction to Bioinformatics II

Gene Mutations.

Mermaid Syndrome Video.

Get ready for a good day!!! (Get Hype!)

Catalyst Create a circle map about mutations. Mutations.

Types of Mutations.

Gene Mutations Chapter 11.

The Central Dogma Through the production of mRNA (transcription), and the synthesis of proteins (translation), the information contained in DNA is expressed.

Mutations Announcement Quiz over Mutations on Monday!

Gene Mutations.

Gene Mutations Essential Question: How do changes in the DNA nucleotide sequence affect the resulting protein?

Protein Synthesis.

Catalyst Create a circle map about mutations. Mutations.

Do Now What is the central dogma of biology?

DNA, RNA, and Proteins By Liz LaRosa

Decode the following message.

DNA, RNA, and Proteins By Liz LaRosa

Welcome to Genetic Mutations!

Distinguish between codon and anticodon.

Chapter 11: DNA- The Molecule of Heredity

Ch 12-4 Genetic Mutations.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Genetic Mutations Karyotype: the number and visual appearance of the chromosomes in the cell nuclei of an organism or species.

Draw a conclusion from this graph for both the red and blue line

1) Base Mutations 2) Chromosomal Mutations

DNA, RNA, and Proteins By Liz LaRosa

Mutation Notes.

C-Notes: Mutations Stnd: BI.4.c 10/23/13

Mutations Notes.

Presentation transcript:

Mutations

I. Mutations -any change in DNA sequence (order of nucleotides) is a mutation. -mutations can occurr during DNA replication, transcription, and cell division

II. Mutations in Reproductive (Sex) Cells -Mutations in sex cells (sperm and egg cells) can lead to changes in the DNA sequence which will be passed down to a person’s children.

III. Mutations in Body Cells -Mutations in body cells cannot be passed on to your children, however, they can cause cancer or other problems in your body. A cancer cell.

III. Cancer as a result of mutations in body cells: A person with skin cancer-This is why it’s important to always wear sunscreen!

III. Cancer as a result of mutations in body cells: Tongue cancer and lung cancer are often caused by changes in body cells as a result of smoking, so don’t smoke!!!

IV. Point mutation -A point mutation is a change in one base pair in a DNA sequence. -A point mutation can cause an amino acid to change, which will change the structure of the protein being made. Example: AUG=Met AAG=Lys -Only one letter was changed (the A to a U) and the entire amino acid changed (from methionine to lysine).

IV. Point mutation Normal Point mutation mRNA Protein Stop mRNA Protein Replace G with A

Results of Point Mutations Missense- Change of one nucleotide base that causes a change in one amino acid Example Correct mRNA = AUG GAA CGC Amino acid= MET-GLU-ARG Mutated mRNA = AUG GGA CGC Amino Acid= MET-GLY-ARG

Results of Point Mutations Nonsense- Change in one nucleotide that results in a stop codon being formed that results in a shortened amino acid chain. Example Correct mRNA = AUG GAA UGG AAC Amino acid= MET-GLU-TRY-ASP Mutated mRNA = AUG GAA UGA AAC Amino Acid= MET-GLU-STOP

Results of Point Mutations Silent- Change in one nucleotide that does not change the amino acid. Example Correct mRNA = AUG GGA CGC Amino acid= MET-GLY-ARG Mutated mRNA = AUG GGU CGC Amino Acid= MET-GLY-ARG

-Frameshift mutations cause the reading frame of the RNA to shift, resulting in the change of ALL amino acids that follow. -A frameshift mutation is much worse than a point mutation because it causes the entire DNA sequence to be shifted over! Example: DNA: ATTAAACCG ATAAACCG V. Frameshift mutation Delete this T

V. Frameshift mutation Example of a Deletion Correct mRNA = AUG GGA CGC ACC GUA Amino acid= MET-GLY-ARG-THR-VAL Mutated mRNA = AUG GAC GCA CCG UA Amino Acid= MET-ASP-ALA-PRO-

Difference between a point mutation and a frameshift mutation.

Questions: Is this a point mutation or a frameshift mutation? -It’s a point mutation because only one nucleotide changed!

Questions: THE DOG BIT THE CAT THE DOG BIT THE CAR Point or frameshift? Point!

Questions THE DOG BIT THE CAT THE DOB ITT HEC AT Point or frameshift? -frameshift