AP Biology Mutations Unit 5B.5. AP Biology Changes in genotype (DNA) can result in changes in phenotype  Alterations in DNA sequence can lead to changes.

Slides:



Advertisements
Similar presentations
Mutations.
Advertisements

Gene Mutations. Target #17- I can describe a gene mutation Gene mutation: a permanent heritable change in the sequence of bases in DNA – Effect can cause.
3.C.1 Effect on Phenotype Changes in genotype can result in changes in phenotype. Watch the following videos ns
Lesson Overview 13.3 Mutations.
Transcription, Translation Review. Mutations and Genetic Modifications.
Gene Mutations.
Section 1: Mutation and Genetic Change
Mutations.
DNA Mutations Biology 6(E).
DNA MUTATIONS.
Lesson Overview Lesson OverviewMutations Lesson Overview 13.3 Mutations.
MUTATIONS SC STANDARD B-4.9: The student will exemplify ways in which new characteristics are introduced into an organism or a population.
Section 11.3 MUTATIONS Section 11.3 pgs
Lesson Overview 13.3 Mutations.
AP Biology Chapter 17 Mutations: Point, Frameshift and Examples.
Ch Mutations Section Objectives:
Unit III Information Essential to Life Processes Learning Goal 3 Explain how the processing of genetic information is imperfect and is a source of genetic.
Mutations
Mutations Gene Mutations Change in the nucleotide sequence of a gene May only involve a single nucleotide May be due to copying errors, chemicals, viruses,
Mutations. A Mutation is a change in an organism’s DNA  It can occur naturally whenever a base is incorrectly copied, especially during DNA Replication.
Microbial Genetics - Mutation l Mutation - Introduction –A mutation is a change in the DNA sequence that results in a change in the product protein –Mutations.
Mutations in DNA changes in the DNA sequence that can be inherited can have negative effects (a faulty gene for a trans- membrane protein leads to cystic.
Genes and Gene Mutations. Gene: a sequence of DNA bases that code for a product, usually a protein. Gene mutation: a change in the sequence of bases.
MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.
 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.
Mutations Chapter Types of Mutations The sequence of bases in DNA are like the letters of a coded message or even the letters of a simple alphabet.
Genes in ActionSection 1 Section 1: Mutation and Genetic Change Preview Bellringer Key Ideas Mutation: The Basis of Genetic Change Several Kinds of Mutations.
Genetic Mutations Biology Chapter 12.4 Wilson.  Describe the different types of genetic mutations.  Describe the different types of chromosomal mutations.
GENETIC MUTATIONS What is this picture depicting?.
13.3 Mutations KeyQuestions: 1)What are mutations? 2)How do mutations affect genes? The sequence of bases in DNA are like the letters of a coded message.
Lesson Overview 13.3 Mutations. THINK ABOUT IT The sequence of bases in DNA are like the letters of a coded message. What would happen if a few of those.
 BUILD-A-BUG ACTIVITY  Build your bug and turn in to your box  Mutations Notes  Mutations practice QUIZ NEXT CLASS: Transcription and Translation TUESDAY.
Mutation. What you need to know How alteration of chromosome number or structurally altered chromosomes can cause genetic disorders How point mutations.
Lesson Overview 13.3 Mutations.
Section 1: Mutation and Genetic Change
Lesson Overview 13.3 Mutations.
Gene Mutations.
Lesson Overview 13.3 Mutations.
Mutations.
DNA MUTATIONS.
Mutations.
DNA Mutations Biology 6(E).
Mutations
DNA and mutations SC.912.L.16.4.
Gene Mutations.
Mutations.
MUTATIONS.
Mutations in the Genetic code
Mutations.
Lecture 3.
Mutations in the Genetic code
Big Idea 3 - Genetics and Information
Types of point mutations
Mutations.
Section 1: Mutation and Genetic Change
Mutations Ms MacCormack Fall 2018.
Lesson Overview 13.3 Mutations Objectives:
MUTATIONS.
Mutations.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
MUTATIONS.
Mutation, Natural Selection, and Artificial Selection
Mutation Notes.
Section 20.4 Mutations and Genetic Variation
Lesson Overview 13.3 Mutations.
Lesson Overview 13.3 Mutations.
Lesson Overview 13.3 Mutations.
Mutations: Changes in Genes
Gene Mutations.
Presentation transcript:

AP Biology Mutations Unit 5B.5

AP Biology Changes in genotype (DNA) can result in changes in phenotype  Alterations in DNA sequence can lead to changes in the type or amount of protein produced and the consequent phenotype

AP Biology Mutation Any change in the DNA sequence  Can be positive, negative, or neutral based on the effect or the lack of effect the mutation has on the resulting nucleic acid or protein and the phenotype determined by that protein

AP Biology Causes of Mutations Errors in DNA replication or DNA repair mechanisms  Wrong base pairing (that doesn’t get caught during proofreading of DNA) External factors  Radiation  Reactive chemicals Whether or not the mutation is detrimental, beneficial or neutral depends on the environmental context

1st to suggest genes dictate phenotypes through enzymes that catalyze specific chemical reactions Postulated that the symptoms of an inherited disease are due to inability to make a specific enzyme Coined term “inborn errors of metabolism” to describe such diseases Beginning of “One gene-one enzyme” hypothesis ALCAPTONURIA- “black urine” disease- defect in enzyme that breaks down amino acid tyrosine ARCHIBALD GARROD 1902

Mutations Point mutations  single base change  base-pair substitution silent mutation  no amino acid change  redundancy in code missense  change amino acid nonsense  change to stop codon Slide from Explore Biology by Kim Foglia

Mutations Frameshift  shift in the reading frame changes everything “downstream”  insertions adding base(s)  deletions losing base(s)  More damaging at beginning of gene than at end Slide modified from: Explore Biology by Kim Foglia

AP Biology Mutations are the primary source of genetic variation in a population Changes in genotype may affect phenotypes that are subject to natural selection (survival of the fittest)  Genetic changes that enhance survival and reproduction can be selected by environmental conditions Antibiotic resistance in bacteria Pesticide resistance Sickle cell anemia

Point mutation leads to Sickle cell anemia What kind of mutation? Slide from Explore Biology by Kim Foglia

Sickle cell anemia Slide from Explore Biology by Kim Foglia

AP Biology Heterozygotes have both normal and sickle cells. These people are normal and healthy. Individuals that have sickle cell anemia (homozygous for the trait) will have slow blood and the blood cells have a shorter life span than normal cells (these people tend to get sicker more frequently and can have serious health problems.)

AP Biology

Evidence Distribution of sickle cell trait Distribution of malaria

AP Biology As is the case with sickle cell anemia, a heterozygote may be a more advantageous genotype than a homozygote under particular conditions, since with different alleles, the organism has two forms of proteins that may provide functional resilience in response to environmental stresses.