PH=7.4 pH=6.8 unreplicated Lagging daughter Leading daughter Supplementary Figure 1: Separation of lagging daughter from unreplicated and leading daughter.

Slides:

Advertisements

Similar presentations

Supplementary Figure 1. AB Supplementary Figure 1. L1 and Alu retrotransposition assay. A. Schematic of L1 retrotransposition plasmid (L1). ORF1 and ORF2.

Advertisements

ER  HSP90 DMSO 200  M I3C30  M DIM200  M TRYPTOPHOL Supplemental Figure 1. DIM and Tryptophol fail to induce the downregulation of ER  seen with I3C.

Days of culture N° of viable cells Supplemental Figure 1. Parental, hTERT.

SKOV3 ~44% SKBR3 ~6% SiHa ~89% CaSki i ~67% HeLa ~89% Supplementary Figure 1 Huisman et al Supplementary Figure 1. DNA methylation status of the EPB41L3.

Wu et al., Supplementary Fig 1 Supplementary Figure 1: The depletion of BRG1 in HeLa cells has no effect on cell proliferation. Sh- empty vector was used.

Figure S1. Production of recombinant NS1 protein

Volume 27, Issue 6, Pages (September 2007)

Volume 17, Issue 9, Pages (November 2016)

Volume 50, Issue 6, Pages (June 2013)

Volume 19, Issue 4, Pages (August 2005)

Multiple Tumor Suppressor Pathways Negatively Regulate Telomerase

Volume 14, Issue 4, Pages (May 2004)

ASF1a Promotes Non-homologous End Joining Repair by Facilitating Phosphorylation of MDC1 by ATM at Double-Strand Breaks Kyung Yong Lee, Jun-Sub Im, Etsuko.

Volume 145, Issue 6, Pages (June 2011)

NoRC regulates telomeric heterochromatin.

Megan van Overbeek, Titia de Lange Current Biology

Volume 9, Issue 4, Pages (April 2002)

NRF2 Is a Major Target of ARF in p53-Independent Tumor Suppression

Volume 19, Issue 12, Pages (June 2017)

Volume 44, Issue 2, Pages (October 2011)

Volume 15, Issue 1, Pages (July 2004)

Volume 22, Issue 7, Pages (February 2018)

Volume 16, Issue 5, Pages (December 2004)

Volume 27, Issue 6, Pages (September 2007)

Volume 16, Issue 15, Pages (August 2006)

MyD88: An Adapter That Recruits IRAK to the IL-1 Receptor Complex

Everolimus Silences E2F Target Genes Through TERT-Dependent Epigenetic Histone Modification (A) Western blotting for MCM7 in WT and TERTtg mSMC treated.

Volume 7, Issue 1, Pages (April 2014)

Purification of Proteins Associated with Specific Genomic Loci

Volume 17, Issue 12, Pages (December 2016)

Antonin Morillon, Nickoletta Karabetsou, Anitha Nair, Jane Mellor

Molecular Therapy - Nucleic Acids

Volume 66, Issue 4, Pages e5 (May 2017)

TRF2 Protects Human Telomeres from End-to-End Fusions

Volume 46, Issue 5, Pages (June 2012)

Volume 2, Issue 6, Pages (December 2012)

The DNA Damage Machinery and Homologous Recombination Pathway Act Consecutively to Protect Human Telomeres Ramiro E. Verdun, Jan Karlseder Cell Volume.

Volume 19, Issue 12, Pages (June 2017)

Volume 56, Issue 5, Pages (December 2014)

Volume 20, Issue 8, Pages (August 2017)

Ramiro E. Verdun, Laure Crabbe, Candy Haggblom, Jan Karlseder

Purification of Human Telomerase Complexes Identifies Factors Involved in Telomerase Biogenesis and Telomere Length Regulation Dragony Fu, Kathleen Collins

Volume 150, Issue 3, Pages (August 2012)

Volume 17, Issue 9, Pages (November 2016)

Volume 17, Issue 22, Pages (November 2007)

Volume 48, Issue 5, Pages (December 2012)

Inhibition of Telomerase Activity by a Hammerhead Ribozyme Targeting the RNA Component of Telomerase in Human Melanoma Cells Marco Folini, Gennaro Colella,

Volume 17, Issue 5, Pages (November 2002)

Telomeric Noncoding RNA TERRA Is Induced by Telomere Shortening to Nucleate Telomerase Molecules at Short Telomeres Emilio Cusanelli, Carmina Angelica Perez.

Volume 123, Issue 5, Pages (December 2005)

Volume 13, Issue 10, Pages (December 2015)

Histone–GFP fusion protein enables sensitive analysis of chromosome dynamics in living mammalian cells Teru Kanda, Kevin F. Sullivan, Geoffrey M. Wahl

Nancy L. Maas, Kyle M. Miller, Lisa G. DeFazio, David P. Toczyski

The Prolyl Isomerase Pin1 Functions in Mitotic Chromosome Condensation

DNA Damage Foci at Dysfunctional Telomeres

Robin M. Ricke, Anja-Katrin Bielinsky Molecular Cell

The BUB3-BUB1 Complex Promotes Telomere DNA Replication

Yap1 Phosphorylation by c-Abl Is a Critical Step in Selective Activation of Proapoptotic Genes in Response to DNA Damage Dan Levy, Yaarit Adamovich,

Short Telomeres in ESCs Lead to Unstable Differentiation

BRCA1 Is a Histone-H2A-Specific Ubiquitin Ligase

Volume 32, Issue 5, Pages (December 2008)

1α,25-Dihydroxyvitamin D3 Stimulates Activator Protein 1 DNA-Binding Activity by a Phosphatidylinositol 3-Kinase/Ras/MEK/Extracellular Signal Regulated.

Volume 42, Issue 3, Pages (May 2011)

Volume 138, Issue 3, Pages (August 2009)

Transcriptional Regulation by p53 through Intrinsic DNA/Chromatin Binding and Site- Directed Cofactor Recruitment Joaquin M Espinosa, Beverly M Emerson

Volume 18, Issue 2, Pages (August 2015)

Volume 2, Issue 4, Pages (October 2012)

Cdk1 Negatively Regulates Midzone Localization of the Mitotic Kinesin Mklp2 and the Chromosomal Passenger Complex Stefan Hümmer, Thomas U. Mayer Current.

Bradford Coffee, Fuping Zhang, Stephanie Ceman, Stephen T

A B C Name Sequence TIMP3 promoter

Presentation transcript:

pH=7.4 pH=6.8 unreplicated Lagging daughter Leading daughter Supplementary Figure 1: Separation of lagging daughter from unreplicated and leading daughter by CsCl gradient centrifugation. The fractions containing telomeric DNA were determined by slot blot.

pH 7.4 pH 6.8 0h6h Supplementary Figure 2: FACS analysis of synchronized HeLa cells released into S phase for different times (0h and 6h).

Internal Control (IC) AB Supplementary Figure 3: Decrease of telomerase activity in clones expressing different levels of shRNA (toward hTERT). (A) TRAP assay to detect telomerase activity in control, clone 7 and clone 14. Cell extract equal to indicated number of cells were used. (B) Quantification of A. Values are ±SD of three independent experiments. Telomerase products NC Cell Number Heating Control Clone7Clone14

01248 pHe 7.4pHe 7.1pHe 6.8 min A B C D Supplementary Figure 4: Unchanged telomere chromatin structure under different pHes. (A) Western blot showed the decreased level of overall histone acetylation ( H4ac and H3K9ac) under acidic pHe. Bands were quantified by Image Q and normalized to the amount at pH 7.4. The fold of change was indicated below the bands. (B) ChIP assay demonstrated equal amount of acetylated histone at telomeres under indicated pHe. (C) Condensation of telomere chromatin was determined by micrococcal nuclease assay. (D) Quantification of C. There is no difference in sensitivity to micrococcal nuclease digestion. Values are ±SD of three independent experiments. H3K9ac H4ac Coomassie H3 pHe

TRF2 GAPDH ControlsgRNA-1sgRNA-2 Supplementary Figure 5: Validation of antibody against TRF2. HeLa cells were transfected with lenti-virus carrying inducible-Cas 9 (pHAGE-TRE-Cas9) and selected with neomycin for 10 days. SgRNAs (sgRNA-1 (CCTTTCGGGGTAGCCGGTA), sgRNA-2 (AACCCGCAGCAATCGGGACA in plasmids p-Lenti) were transiently transfected into the cells and induced with doxycyclin (1µg/ml) for 3 days. Cells were harvested for analysis. Empty vector was used as a control.

DAPIhTRCoilinMerge A B Supplementary Figure 6: Colocalization of hTR with Cajal bodies under different pHe conditions. (A) Number of Cajal bodies in cells cultured at indicated pHe. (B) Colocalizaiton of hTR with Cajal bodies under indicated pH. Values are ±SD of three independent experiments.

Coilin Telo TRF2 Merge pH TRF2/Telo Coilin/Telo/TRF2 6.8 A B C Supplementary Figure 7: Cajal bodies are preferentially recruited to shorter telomeres that lack detectable TRF2. (A) Cajal Bodies and TRF2 are visualized by IF using antibody against coilin and TRF2, while telomeres are detected by FISH. (B) Quantification of A showing percentage of Cajal Body (CB) colocalized with TRF2- negative telomeres in cells grown at indicated pHe. (C) Quantification of A showing the length (RTL in FISH) of Cajal body (CB)-occupied telomeres and average length of total telomeres (CB-occupied plus CB-free telomeres) in cells grown at indicated pH. P value was calculated using the Student’s t-test.