DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictate the order of amino acids that make up a protein Protein Synthesis Nucleotide sequence of His gene

Location of the His gene

Nucleotide sequence of the His gene

Protein Synthesis Nucleotide sequence of His gene Amino acid sequence of His protein DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictate the order of amino acids that make up a protein

Amino acid sequence of His protein

Protein synthesis occurs in two primary steps Protein Synthesis mRNA (messenger RNA) copy of a gene is synthesized Cytoplasm of prokaryotes Nucleus of eukaryotes 1 mRNA is used by ribosome to build protein (Ribosomes attach to the mRNA and use its sequence of nucleotides to determine the order of amino acids in the protein) Cytoplasm of prokaryotes and eukaryotes Some proteins feed directly into rough ER in eukaryotes 2

(eukaryotes) Protein Synthesis 1) INITIATION Transcription Initiation RNA polymerase binds to a region on DNA known as the promoter, which signals the start of a gene Promoters are specific to genes RNA polymerase does not need a primer Transcription factors assemble at the promoter forming a transcription initiation complex – activator proteins help stabilize the complex Gene expression can be regulated (turned on/off or up/down) by controlling the amount of each transcription factor

Protein Synthesis 1) INITIATION Transcription Elongation RNA polymerase unwinds the DNA and breaks the H-bonds between the bases of the two strands, separating them from one another Base pairing occurs between incoming RNA nucleotides and the DNA nucleotides of the gene (template) recall RNA uses uracil instead of thymine AGTCAT UCAGUA

Protein Synthesis Transcription Elongation RNA polymerase unwinds the DNA and breaks the H-bonds between the bases of the two strands, separating them from one another. Base pairing occurs between incoming RNA nucleotides and the DNA nucleotides of the gene (template) recall RNA uses uracil instead of thymine RNA polymerase catalyzes bond to form between ribose of 3’ nucleotide of mRNA and phosphate of incoming RNA nucleotide 3’ 5’ 3’ 5’ + ATP + ADP

Protein Synthesis Transcription Elongation The gene occurs on only one of the DNA strands; each strand possesses a separate set of genes

Protein Synthesis 1) INITIATION Transcription Termination A region on DNA known as the terminator signals the stop of a gene RNA polymerase disengages the mRNA and the DNA

Exons are “coding” regions Introns are removed different combinations of exons form different mRNA resulting in multiple proteins from the same gene Humans have 30,000 genes but are capable of producing 100,000 proteins Protein Synthesis Alternative Splicing (eukaryotes only)

Web Resources Transcription Alternative Splicing

mRNA copy of a gene is synthesized Cytoplasm of prokaryotes Nucleus of eukaryotes 1 Protein Synthesis mRNA is used by ribosome to build protein (Ribosomes attach to the mRNA and use its sequence of nucleotides to determine the order of amino acids in the protein) Cytoplasm of prokaryotes and eukaryotes Some proteins feed directly into rough ER in eukaryotes 2 mRNA Transcription Translation mRNA tRNA synthesis

Transcription Translation mRNA tRNA synthesis Protein Synthesis Translation Every three mRNA nucleotides (codon) specify an amino acid

Protein Synthesis Translation tRNA have an anticodon region that specifically binds to its codon

Transcription Translation mRNA tRNA synthesis Protein Synthesis Translation Each tRNA carries a specific amino acid

Transcription Translation mRNA tRNA synthesis Protein Synthesis Aminoacyl tRNA synthetases attach amino acids to their specific tRNA

Protein Synthesis Translation Initiation Start codon signals where the gene begins (at 5’ end of mRNA) AUGGACAUUGAACCG… 5’3’ start codon Transcription Translation mRNA tRNA synthesis

Protein Synthesis Translation Initiation Start codon signals where the gene begins (at 5’ end of mRNA) Ribosome binding site (Shine Dalgarno sequence) upstream from the start codon binds to small ribosomal subunit –then this complex recruits the large ribosomal subunit Small ribosomal subunit Ribosome Large ribosomal subunit

Protein Synthesis Translation Scanning The ribosome moves in 5’ to 3’ direction “reading” the mRNA and assembling amino acids into the correct protein large ribosome subunit small ribosome subunit

Protein Synthesis Translation Scanning The ribosome moves in 5’ to 3’ direction “reading” the mRNA and assembling amino acids into the correct protein

Protein Synthesis Translation Termination Ribosome disengages from the mRNA when it encounters a stop codon

Web Resources Translation Eukaryotic: Prokaryotic:

Practice Question Translate the following mRNA sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC

Practice Question Translate the following mRNA sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC Serine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine

Ser – Tyr – His – Thr – His – Pro – Ser – Ser – Ser - Ser Practice Question Translate the following mRNA sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC Serine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine

Practice Question Translate the following mRNA sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC S – Y –H– T – H – P – S – S – S - S Ser – Tyr – His – Thr – His – Pro – Ser – Ser – Ser - Ser

Protein Synthesis Multiple RNA polymerases can engage a gene at one time Multiple ribosomes can engage a single mRNA at one time DNA mRNAs Transcription Translation

Protein Synthesis Eukaryotes: transcription occurs in the nucleus and translation occurs in the cytoplasm Prokaryotes: Transcription and translation occur simultaneously in the cytoplasm

There are four main types of RNA: 1.mRNA - RNA copy of a gene used as a template for protein synthesis 2.rRNA - part of structure of ribosomes 3.tRNA - amino acid carrier that matches to mRNA codon 4.snRNA - found in nucleus where they have several important jobs RNA

1.Why is DNA synthesis said to be “semiconservative”? 2.What role do DNA polymerase, DNA primase (a type of RNA polymerase), helicase, topoisomerase, RNase H, and ligase play in DNA replication? 3.What is the difference between how the leading strand and lagging strand are copied during DNA replication? Why do they have to be synthesized differently in this fashion? 4.What would happen if insufficient RNase H were produced by a cell? What if insufficient ligase were produced by a cell? 5.What are four key differences between DNA polymerase and RNA polymerase? (“they are difference molecules” doesn’t count as one!) 6.Compare and contrast codons and anticodons? 7.What is alternative splicing? Why is it necessary in eukaryotes? 8.During translation, what amino acid sequence would the following mRNA segment be converted into: AUGGACAUUGAACCG? 9.How come there are only 20 amino acids when there are 64 different codons? 10.How come prokaryotes can both transcribe and translate a gene at the same time, but eukaryotes cannot? Practice Questions

Web Resources Transcription Translation Eukaryotic: Prokaryotic: Alternative Splicing

Insulin Example of Protein Synthesis Hemoglobin Example of Protein Synthesis Collagen Example of Protein Synthesis Web Resources

Images