Supplementary Material The phytohormone ethylene enhances cellulose production, regulates CRP/FNR transcription, and causes differential gene expression.

Slides:

Advertisements

Similar presentations

Supplementary Figure 1. AB Supplementary Figure 1. L1 and Alu retrotransposition assay. A. Schematic of L1 retrotransposition plasmid (L1). ORF1 and ORF2.

Advertisements

Table 2 shows that the set TFsf-TGblbs of predicted regulatory links has better results than the other two sets, based on having a significantly higher.

University of Oklahoma Genome Center4/14/12.

Logo Introduction To investigate if white 96-well plates allow better fluorescence detection of PCR products during QPCR assays than natural 96-well plates.

Ct log DNA （ pmol) P1P2 Supplementary Fig. S1 Standard curve of the PCR amplification efficiency of transcripts.

Fig. S1 Mass spectra analysis of XXT4 reaction products demonstrating xylosyltransferase activity towards cellohexaose substrate. Predominant peaks represent.

Supplemental Figure 1a. SDS-PAGE analysis showing OMPs expressed by V. tubiashii strain From left to right, Lane 1, cells grown in the presence.

min 30 min 45 min 60 min KDa Figure S1. SDS-PAGE of supernatant after incubation in digestion buffer. L. monocytogenes.

WT#3#5#7#9#11#14#15#20#25#30 35S::JAZ13 Root length ratio * * * * * * * * * * Figure S2. Overexpression of native (untagged)

SPECIFICITY and SENSITIVITY – Performance of Applied qPCR Assays A Bacteria Methanogenic Archaea F FBacteria F FF F Supplementary Figure 1: Specificity.

Date of download: 5/28/2016 Copyright © 2016 American Medical Association. All rights reserved. From: Increased BDNF Promoter Methylation in the Wernicke.

H. influenzae genes differentially regulated during growth in complex media and during lung infection in the presence of corticosteroids AVenn diagram.

Clinical Laboratory Analysis of Immunoglobulin Heavy Chain Variable Region Genes for Chronic Lymphocytic Leukemia Prognosis Philippe Szankasi, David.

Chapter 8, part B Microbial Genetics.

Chapter 8, part B Microbial Genetics.

Supplementary figure 5.

Figure 1. miRNA processing and primer design

Targeting Multidrug-resistant Staphylococci with an anti-rpoA Peptide Nucleic Acid Conjugated to the HIV-1 TAT Cell Penetrating Peptide Mostafa FN Abushahba,

* * * Fig. S1 XB21-Os12g36180 Os11g43950 At4g12770 At4g

One-Step Ligation on RNA Amplification for the Detection of Point Mutations Lei Zhang, Jingjing Wang, Mia Coetzer, Stephanie Angione, Rami Kantor, Anubhav.

Optimization of a Relative Telomere Length Assay by Monochromatic Multiplex Real- Time Quantitative PCR on the LightCycler 480 Anthony Y.Y. Hsieh, Sara.

Volume 61, Issue 1, Pages (January 2002)

Suppression of Wild-Type Amplification by Selectivity Enhancing Agents in PCR Assays that Utilize SuperSelective Primers for the Detection of Rare Somatic.

Volume 39, Issue 3, Pages (August 2010)

Volume 6, Issue 2, Pages (January 2014)

Volume 9, Issue 12, Pages (December 2016)

Volume 28, Issue 3, Pages (November 2007)

Regulation of Ceramide Biosynthesis by TOR Complex 2

Spatiotemporal Brassinosteroid Signaling and Antagonism with Auxin Pattern Stem Cell Dynamics in Arabidopsis Roots Juthamas Chaiwanon, Zhi-Yong Wang

Clinical Laboratory Analysis of Immunoglobulin Heavy Chain Variable Region Genes for Chronic Lymphocytic Leukemia Prognosis Philippe Szankasi, David.

Isothermal Strand-Displacement Polymerase Reaction for Visual Detection of the Southeast Asian–Type Deletion of α-Thalassemia Luxin Yu, Wei Wu, Puchang.

Volume 65, Issue 1, Pages (January 2017)

Volume 7, Issue 1, Pages (April 2014)

Volume 112, Issue 10, Pages (May 2017)

Volume 94, Issue 6, Pages (September 1998)

Molecular Therapy - Oncolytics

Supplemental Figure 3 A B C T-DNA 1 2 RGLG1 2329bp 3 T-DNA 1 2 RGLG2

Effect of CSP18 on induction of competence and expression of cipB, sigX, comGA, and comEC during growth in TSB. (A) During growth of S. mutans UA159 in.

An RNA Sensor for Intracellular Mg2+

The Conserved NDR Kinase Orb6 Controls Polarized Cell Growth by Spatial Regulation of the Small GTPase Cdc42 Maitreyi Das, David J. Wiley, Xi Chen, Kavita.

Nitric Oxide Inhibits Cornified Envelope Formation in Human Keratinocytes by Inactivating Transglutaminases and Activating Protein 1 Antonello Rossi,

Regulation of ChIP-seq target genes by MED12 methylation.

Johnson Cheung, Michael E.P. Murphy, David E. Heinrichs

Interplay between Nonsense-Mediated mRNA Decay and DNA Damage Response Pathways Reveals that Stn1 and Ten1 Are the Key CST Telomere-Cap Components Eva-Maria.

Volume 37, Issue 6, Pages (March 2010)

Bar plot representation of the transcriptomic changes in Δsaci_ptp and Δsaci_pp2a. Bar plot representation of the transcriptomic changes in Δsaci_ptp and.

Differential expression levels of archaella operon genes and respiratory chain genes in Δsaci_pp2a and Δsaci_ptp. Differential expression levels of archaella.

Mutation of a Gene in the Fungus Leptosphaeria maculans Allows Increased Frequency of Penetration of Stomatal Apertures of Arabidopsis thaliana Elliott.

Volume 53, Issue 5, Pages (March 2014)

Characterization of Keratinocyte Differentiation Induced by Ascorbic Acid: Protein Kinase C Involvement and Vitamin C Homeostasis1 Isabella Savini, Antonello.

Design and optimization of the computational model.

Repression of MYBL2 by Both microRNA858a and HY5 Leads to the Activation of Anthocyanin Biosynthetic Pathway in Arabidopsis Yulong Wang, Yiqing Wang,

Volume 58, Issue 3, Pages (May 2015)

Belén López-García, Phillip H. A. Lee, Kenshi Yamasaki, Richard L

Tradeoffs and Optimality in the Evolution of Gene Regulation

Volume 37, Issue 3, Pages (May 2016)

Col max1-1 max3-9 max4-11 Atd14-1 max2-4 ein2-5 ein3-1 eil1-3 0 day

* * * * * * * Supplemental Figure 3. GO Cellular Component Annotation Analysis of SA-Regulated Gene-Networks. We analyzed the genes in the gene-networks.

Analyzing Fission Yeast Multidrug Resistance Mechanisms to Develop a Genetically Tractable Model System for Chemical Biology Shigehiro A. Kawashima,

Paul B. Mason, Kevin Struhl Molecular Cell

Volume 5, Issue 6, Pages (November 2012)

Volume 30, Issue 2, Pages (April 2008)

Chapter 8, part B Microbial Genetics.

PtrHB7, a class III HD-Zip Gene, Plays a Critical Role in Regulation of Vascular Cambium Differentiation in Populus Yingying Zhu, Dongliang Song, Jiayan.

A Novel System for Xylem Cell Differentiation in Arabidopsis thaliana

Transcriptional Regulation by p53 through Intrinsic DNA/Chromatin Binding and Site- Directed Cofactor Recruitment Joaquin M Espinosa, Beverly M Emerson

Cvt19 Is a Receptor for the Cytoplasm-to-Vacuole Targeting Pathway

A Light-Independent Allele of Phytochrome B Faithfully Recapitulates Photomorphogenic Transcriptional Networks Wei Hu, Yi-Shin Su, J. Clark Lagarias

CRISPRi repression with dCas9-repressor fusion constructs.

Presentation transcript:

Supplementary Material The phytohormone ethylene enhances cellulose production, regulates CRP/FNR transcription, and causes differential gene expression within the bacterial cellulose synthesis operon of Komagataeibacter (Gluconacetobacter) xylinus ATCC Richard V. Augimeri 1 and Janice L. Strap 1* 1 Molecular Microbial Biochemistry Laboratory, Faculty of Science, University of Ontario Institute of Technology, Oshawa, ON, Canada * Correspondence: Janice L. Strap:

Supplementary Figures

Supplementary Figure 1. Triple response of Arabidopsis thaliana to ethylene. Schematic (A-C) illustrating the composition of each quadrant. Photographs (D-F) show the assay plates for the negative control (A, D), the positive control (B, E) and the experimental (ethephon) (C, F) triple response.

Supplementary Figure 2. Ethephon-derived ethylene causes an increase in the final pH of K. xylinus broth cultures. Cultures were grown in SH broth (pH 7) supplemented with ethephon and 0.2% (v/v) cellulase, incubated at 30 o C with agitation at 150 rpm. Data was normalized to, and expressed as percent of the untreated control. Data presented indicates the final culture pH after 14 days of growth. Note that the y-axis begins at 50%. Error bars show SD (n = 3). *** = p <

Supplementary Figure 3. Ethephon does not affect the growth of K. xylinus when grown in agitated liquid culture. Cultures were grown in the presence of ethephon that was added at the time of inoculation (A) and every 2 days (B). The legend indicates the ethephon concentrations tested. Cultures were grown in a 96-well plate in SH broth (pH 7) supplemented with 0.4% (v/v) cellulase incubated at 30 o C with agitation at 150 rpm. Error bars show SD (n = 3).

Supplementary Figure 4. Standard curve (A) and melt-curve (B) analysis for 23SrRNA primer set. Amplification efficiency (E) is shown in the standard curve. A single peak in the melt-curve indicates the RT-qPCR reaction is specific. No template controls (NTCs) produced no peak in the melt-curve (red line). (A)(B)

Supplementary Figure 5. Standard curve (A) and melt-curve (B) analysis for gyrB primer set. Amplification efficiency (E) is shown in the standard curve. A single peak in the melt-curve indicates the RT-qPCR reaction is specific. No template controls (NTCs) produced no peak in the melt-curve (red line). (A)(B)

Supplementary Figure 6. Standard curve (A) and melt-curve (B) analysis for bcsA primer set. Amplification efficiency (E) is shown in the standard curve. A single peak in the melt-curve indicates the RT-qPCR reaction is specific. No template controls (NTCs) produced no peak in the melt-curve (red line). (A)(B)

Supplementary Figure 7. Standard curve (A) and melt-curve (B) analysis for bcsB primer set. Amplification efficiency (E) is shown in the standard curve. A single peak in the melt-curve indicates the RT-qPCR reaction is specific. No template controls (NTCs) produced no peak in the melt-curve (red line). (A)(B)

Supplementary Figure 8. Standard curve (A) and melt-curve (B) analysis for bcsC primer set. Amplification efficiency (E) is shown in the standard curve. A single peak in the melt-curve indicates the RT-qPCR reaction is specific. No template controls (NTCs) produced no peak in the melt-curve (red line). (A)(B)

Supplementary Figure 9. Standard curve (A) and melt-curve (B) analysis for bcsD primer set. Amplification efficiency (E) is shown in the standard curve. A single peak in the melt-curve indicates the RT-qPCR reaction is specific. No template controls (NTCs) produced no peak in the melt-curve (red line). (A)(B)

Supplementary Figure 10. Standard curve (A) and melt-curve (B) analysis for cmcAx primer set. Amplification efficiency (E) is shown in the standard curve. A single peak in the melt-curve indicates the RT-qPCR reaction is specific. No template controls (NTCs) produced no peak in the melt-curve (red line). (A)(B)

Supplementary Figure 11. Standard curve (A) and melt-curve (B) analysis for ccpAx primer set. Amplification efficiency (E) is shown in the standard curve. A single peak in the melt-curve indicates the RT-qPCR reaction is specific. No template controls (NTCs) produced no peak in the melt-curve (red line). (A)(B)

Supplementary Figure 12. Standard curve (A) and melt-curve (B) analysis for bglAx primer set. Amplification efficiency (E) is shown in the standard curve. A single peak in the melt-curve indicates the RT-qPCR reaction is specific. No template controls (NTCs) produced no peak in the melt-curve (red line). (A)(B)

Supplementary Figure 13. Standard curve (A) and melt-curve (B) analysis for crp/fnr Kx primer set. Amplification efficiency (E) is shown in the standard curve. A single peak in the melt-curve indicates the RT-qPCR reaction is specific. No template controls (NTCs) produced no peak in the melt-curve (red line). (A)(B)

Supplementary Tables

1 Represents the strains of K. xylinus whose genome sequences were used to design each primer set 2 These locus tags identify each gene and can be found within the genome sequences of the respective K. xylinus strain. 3 Locus tag- Genome accession: AP Locus tag- Genome accession: CP Gene accession numbers Supplemental Table 1. Details of primer sets used in this study. GeneDesign Strain 1 Accession/Locus Tag 2 Amplicon length (bp)Forward primer sequence (5’→3’)Reverse primer sequence (5’→3’) Reference Genes 23SrRNANBRC 3288GLX_r TGAGCTGGGTTTAGAACGTCGTGACACCTGGCCTATTGACGTGATG gyrBE25H845_ TCTCGTCACAGACCAAGGACAAGCTTCCTTGGGGTGGGTTTCAAAC Target Genes bcsAATCC 53582X ACAATGGGCTGGATGGTCGAACCCGCAAAAGAAGGTCGCA bcsBATCC 53582X AATGCGTTCCATCTTGGGCTTGACATCAGGTCAAGATAGGCGCCAACA bcsCATCC 53582X TACCAGTCGCATATCGGCAATCGTGCAGGTCGTTCAACTGGCTTTCAT bcsDATCC 53582X TCACCCTGTTTCTTCAGACCCTGTTCAGTTCGATCTGCAGCTTGTCCA cmcAxATCC 53582AB CACCAACCTGCAGCATACCAATGACGCCATCTGTGGCATTGTTCTTGT ccpAxATCC 53582AB TGTTGCCGATGAATGGAGTCCTGTTGTCTGTCTTGGTCATGCTGGTCA bglAxATCC 53582AB TACCGATCAGGAACTTGTCTATCAAAAGTGGTGTAGGTCAGG crp/fnr Kx E25H845_ TCAGGCAGCGCCTTGAACAGCTTGACCTGACATTTCCCGCCTGTCCGAAGCAGC

Gene[Primer] (nM)T a, opt. ( o C)E (%)R2R2 [Template] (dilution factor) Reference Genes 23SrRNA X gyrB X Target Genes bcsA X bcsB X bcsC X bcsD X cmcAx X ccpAx X bglAx X crp/fnr Kx X Supplemental Table 2. Results of RT-qPCR assay optimization.