Case studies of transcriptional regulation 526-301. Dr Mike Dyall-Smith, lab 3.07 Types of transcriptional regulation The first ‘engineered’ promoter: the tac promoter A high level, tightly-controlled expression vector: the pET system

Promoter specificity: sigma factors Lewin, Schaecter et al.

Transcriptional repression or activation

From Schaecter et al.

Types of transcriptional control of gene expression From Schaecter et al.

Types of transcriptional control of gene expression From Schaecter et al.

Types of transcriptional control of gene expression Translation can affect transcription From Schaecter et al.

ATTENUATION - the trp operon (tryptophan biosynthesis genes) From Schaecter et al.

ATTENUATION - the trp operon (tryptophan biosynthesis genes) From Schaecter et al.

ATTENUATION - the trp operon Two alternate secondary structures can form termination Anti-termination: allows transcription of all trp genes From Schaecter et al.

ATTENUATION - the trp operon From Schaecter et al.

The tac promoter. The tac promoter: a functional hybrid derived from the trp and lac promoters. de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25 Dr Mike Dyall-Smith, 2007

The tac promoter: a functional hybrid derived from the trp and lac promoters. de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25 Important paper, but in 1983 this was before PCR enzymes and oligonucleotides expensive sequencing moderately difficult personal computers not common Dr Mike Dyall-Smith, 2007

The tac promoter: a functional hybrid derived from the trp and lac promoters. de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25 1983: Bacterial promoters still poorly understood. Relative efficiencies unexplored. Hybrid promoters never before made. Here they could switch the -35 box from trp to lac and achieve a higher transcription rate of HGH in E.coli Dr Mike Dyall-Smith, 2007

The tac promoter: a functional hybrid derived from the trp and lac promoters. de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25 What was desired for biotechnological production of enzymes and hormones in E.coli was a highly regulated promoter, that could be easily turned ON (from OFF) when cells were grown in standard rich medium in a large fermentor. Why do you need to control the promoter ? Dr Mike Dyall-Smith, 2007

The tac promoter: a functional hybrid derived from the trp and lac promoters. de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25 The promoters used in these studies were: Tryptophan (trp) operon: genes involved in tryptophan biosynthesis. Needed most of the time - except when Trp is in the environment, then it needs to be shut down (repressed) Lactose (lac) operon: needed rarely, only when environment is low in glucose but high in lactose. In this case, the lac operon is induced. Dr Mike Dyall-Smith, 2007

trp operon controlled by repression NEGATIVE CONTROL of transcription Tryptophan synthesis is shut down if Tryp is available from the medium. Tryp acts as a co-repressor to repress biosynthesis From Genes V, Lewin Dr Mike Dyall-Smith, 2007

Control systems for the lac operon CAP LacI Senses lactose via allolactose Senses low glucose via cAMP levels From Genes V, Lewin Dr Mike Dyall-Smith, 2007

Activity of lac operon depends on cAMP+CAP and inducer+LacI RNAP +ve CAP P O1 lacI lacZ, Y, A... CAP site High cAMP (=low glucose) Lactose (-> allolactose) Dr Mike Dyall-Smith, 2007 From Genes V, Lewin

Consensus Bacterial Promoter Sequence (recognized by RNA polymerase-sigma70) Startpointof transcription Three main parts, the -35, -10 consensus sequences and the start point (usually purine) Fig 14.14, Genes V (Lewin) Dr Mike Dyall-Smith, 2007

lacUV5 promoter: -10 mutant lac UV5    TTTACA -- 18 -- TATAAT lac wild-type  TTTACA -- 18 -- TATGTT 17 is best Consensus promoter lac UV5 has a -10 hexamer mutation that makes it identical to consensus in that region. de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25 Dr Mike Dyall-Smith, 2007

trp and lac promoters: Consensus promoter 17 is best lac UV5    TTTACA -- 18 -- TATAAT trp   TTGACA -- 17 -- TAACTA 17 is best Consensus promoter de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25 Dr Mike Dyall-Smith, 2007

Consensus Bacterial Promoter - gives strongest initiation of transcription trp promoter had a perfect (consensus) -35 box lac promoter had a perfect (consensus) -10 box - could a consensus promoter be constructed that retained lacI regulation ? Fig 14.14, Genes V (Lewin) Dr Mike Dyall-Smith, 2007

trp and lac operators lac O1 de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25 Dr Mike Dyall-Smith, 2007

A hybrid promoter -> consensus sequence lac O1 de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25 Dr Mike Dyall-Smith, 2007

Construction of hybrid promoters -35 -10 lac O1 de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25 Dr Mike Dyall-Smith, 2007

Source of trp and lac promoters HpaII TaqI TCGA AGCT CCGG GGCC T . . AGC CGG . . C ligate de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25 Dr Mike Dyall-Smith, 2007

Source of trp and lac promoters de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25 Dr Mike Dyall-Smith, 2007

tacI promoter construction de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25 Dr Mike Dyall-Smith, 2007

tacI promoter construction de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25 Dr Mike Dyall-Smith, 2007

Production of HGH using lac UV5 and tacI promoter constructs Inducer added This shows tacI can be repressed and induced effectively, better than lacUV5 lacUV5 de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25 Dr Mike Dyall-Smith, 2007

Production of HGH using lac UV5 and tacI promoter constructs IPTG Inducer added Tested in an E.coli strain (D1210) with a mutant lacI gene, lacIq, which over-expresses the lacI repressor. lacUV5 de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25 Dr Mike Dyall-Smith, 2007

Inducers of the lac operon Dr Mike Dyall-Smith, 2007

lacIq mutation: up-promoter caccatcgaatggtgcaaaacctttcgcggtatggcatgat caccatcgaatggcgcaaaacctttcgcggtatggcatgat -35 -10 Not close to consensus to begin with. Why? Higher levels of LacI protein in cell. What effect would this have on regulation? Dr Mike Dyall-Smith, 2007

lacI lacZ P O3 O1 O2 The lac operon has THREE lac repressor recognition sites in a stretch of 500 bp; at the positions of three operator sites, O1, O2, and O3. O1 lies within the promoter. O2 lies 401 bp downstream of O1, within the lac Z gene. O3 is in the lac I gene, 93 bp upstream of O1 * O2, O3 much weaker than O1 O3 O1 From Genes V, Lewin Dr Mike Dyall-Smith, 2007

Promoter-reporter plasmid This was constructed to measure the relative strengths of promoters. Galactokinase is an easily measured enzyme. de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25 Dr Mike Dyall-Smith, 2007

Promoter-reporter plasmid results Multicopy plasmid titrates out lacI (they added IPTG also), and tac promoters lack trpR operator, so they are fully de-repressed. de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25 Dr Mike Dyall-Smith, 2007

Promoter-reporter plasmid results Want to see maximum promoter activity so: Multicopy plasmid titrates out lacI To be sure, they added IPTG also, to remove any LacI that could bind. tac promoters lacked a complete trpR operator To be sure, they grew in very low tryp medium e) To see if there was any possibility that the TrpR repressor may be lowering the level of transcription they tested a trpR- host (HDB2) de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25 Dr Mike Dyall-Smith, 2007

trp promoter about 2x lac promoter de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25 Dr Mike Dyall-Smith, 2007

Surprise: trpR is still repressing trp promoter under these conditions. So the trp promoter is really 3x stronger than lac promoter. de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25 Dr Mike Dyall-Smith, 2007

tac promoters ~ 7-11x lac promoter But the ratios are not as good if you take the higher value for trp. de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25 Dr Mike Dyall-Smith, 2007

Promoter-reporter plasmid results HDB2 = trpR- and C600 = trpR+ de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25 Dr Mike Dyall-Smith, 2007

The tac promoter: a functional hybrid derived from the trp and lac promoters. de Boer et al. (1983) Proc.Nat. Acad. Sci. 80:21-25 SUMMARY They produced a functional hybrid promoter. tacI gave far stronger promoter activity than the natural lac or trp promoters. Expressed HGH under inducible control using tacI That was 1983. How would you do it nowdays? Did they show the HGH was active? Dr Mike Dyall-Smith, 2007

Physician Prescribed Human Growth Hormone (hGH) Human growth hormone (hGH) replacement therapy is one of the most promising of all the anti-aging treatments. Ongoing medical research and clinical studies indicate that six months of hGH replacement therapy can reverse several bio-markers of aging by TEN to TWENTY years! Reported effects of human growth hormone therapy include: decreased body fat, increased lean mass, increased bone density, increased energy levels, improved skin tone and texture, improved immune system function, and a greater sense of well-being. http://www.lifespanlongevity.com/ Dr Mike Dyall-Smith, 2007

Tighter control, Higher expression? The pET system of expression vectors and E.coli host strains, developed by Novogen Key elements: Use a T7 phage RNA polymerase - highly specific Clone gene under T7 promoter control (not recognised by E.coli RNA pol.) + lacO (and lacI) Use tight control of T7 RNA polymerase expression (phage infection or lacUV5 control of T7 gene) Can include plasmid pLys expressing T7 lysozyme, a natural inhibitor of T7 RNA pol (mops up small levels)

pET series of expression vectors Gene of interest cloned downstream of a T7 consensus promoter sequence, and a lacO sequence. Transcription can only occur when… ? pET plasmid Novogen

pET series of expression vectors Source of T7 RNA polymerase: T7 gene is integrated into the host cell chromosome, and its promoter has been changed to lac, with the lacO. T7 RNAP will only be produced when …. ?

pET series of expression vectors Lac promoter, even when repressed is leaky, and will produce a small amount of mRNA and so, a bit of T7 RNAP. Can include another gene, coding for T7 lysozyme, that is expressed at low levels, and inhibits T7 RNAP

SUMMARY Various types of transcriptional control of gene expression. (sigma factor, repression, activation, attenuation) tac promoter designed to provide the best characteristics of the trp and lac promoters for high level, but tightly controllable gene expression pET vectors are more recent, and provide tighter control (particularly where the product is toxic to the cell), and much higher transcription rates. Dr Mike Dyall-Smith, 2007