1 PROTEIN SYNTHESIS

2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation  mRNA must be processed before it leaves the nucleus of eukaryotic cells

3 Transcription Translation DNA mRNA Ribosome Protein Prokaryotic Cell DNA  RNA  Protein

4 Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell

5 Pathway to Making a Protein DNAmRNA tRNA (ribosomes) Protein

6. 5’ to 3’ Sugars When the DNA double helix unwinds, it resembles a ladder When the DNA double helix unwinds, it resembles a ladder The sides of the ladder are the sugar-phosphate backbones The sides of the ladder are the sugar-phosphate backbones The rungs of the ladder are the complementary paired bases The rungs of the ladder are the complementary paired bases The two DNA strands are anti-parallel (they run in opposite directions)

7 Anti- Parallel Strands of DNA

8 RNA

9 RNA Differs from DNA 1.RNA has a sugar ribose DNA has a sugar deoxyribose 2.RNA contains the base uracil (U) DNA has thymine (T) 3.RNA molecule is single-stranded DNA is double-stranded

10 Structure of RNA

11. Three Types of RNA Messenger RNA (mRNA) carries genetic information to the ribosomesMessenger RNA (mRNA) carries genetic information to the ribosomes Ribosomal RNA (rRNA), along with protein, makes up the ribosomesRibosomal RNA (rRNA), along with protein, makes up the ribosomes Transfer RNA (tRNA) transfers amino acids to the ribosomes where proteins are synthesizedTransfer RNA (tRNA) transfers amino acids to the ribosomes where proteins are synthesized

12 Making a Protein

13 Genes & Proteins  Proteins are made of amino acids linked together by peptide bonds  20 different amino acids exist  Amino acids chains are called polypeptides  Segment of DNA that codes for the amino acid sequence in a protein are called genes

14 Two Parts of Protein Synthesis  Transcription makes an RNA molecule complementary to a portion of DNA  Translation occurs when the sequence of bases of mRNA DIRECTS the sequence of amino acids in a polypeptide

15 Genetic Code  DNA contains a triplet code  Every three bases on DNA stands for ONE amino acid  Each three-letter unit on mRNA is called a codon  Most amino acids have more than one codon!  There are 20 amino acids with a possible 64 different triplets  The code is nearly universal among living organisms

16

17 Overview of Transcription  During transcription in the nucleus, a segment of DNA unwinds and unzips, and the DNA serves as a template for mRNA formation  RNA polymerase joins the RNA nucleotides so that the codons in mRNA are complementary to the triplet code in DNA

18 Steps in Transcription  The transfer of information in the nucleus from a DNA molecule to an RNA molecule  Only 1 DNA strand serves as the template  Starts at promoter DNA (TATA box)  Ends at terminator DNA (stop)

19 RNA Polymerase  Enzyme found in the nucleus  Separates the two DNA strands by breaking the hydrogen bonds between the bases  Then moves along one of the DNA strands and links RNA nucleotides together

20 Question:  What would be the complementary RNA strand for the following DNA sequence? DNA 5’-GCGTATG-3’

21 Answer: DNA 5’-GCGTATG-3’DNA 5’-GCGTATG-3’ RNA 3’-CGCAUAC-5’RNA 3’-CGCAUAC-5’

22 Messenger RNA (mRNA) Carries the information for a specific proteinCarries the information for a specific protein Made up of 500 to 1000 nucleotides longMade up of 500 to 1000 nucleotides long Sequence of 3 bases called codonSequence of 3 bases called codon AUG – methionine or start codonAUG – methionine or start codon UAA, UAG, or UGA – stop codonsUAA, UAG, or UGA – stop codons

23 Messenger RNA (mRNA) methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon codon 2codon 3codon 4codon 5codon 6codon 7codon 1

24 Transfer RNA (tRNA) Made up of 75 to 80 nucleotides longMade up of 75 to 80 nucleotides long Picks up the appropriate amino acid floating in the cytoplasmPicks up the appropriate amino acid floating in the cytoplasm Transports amino acids to the mRNATransports amino acids to the mRNA Have anticodons that are complementary to mRNA codonsHave anticodons that are complementary to mRNA codons Recognizes the appropriate codons on the mRNA and bonds to them with H-bondsRecognizes the appropriate codons on the mRNA and bonds to them with H-bonds

25 Transfer RNA (tRNA) amino acid attachment site UAC anticodon methionine amino acid

26 Ribosomal RNA (rRNA) Made up of rRNA is 100 to 3000 nucleotides longMade up of rRNA is 100 to 3000 nucleotides long Made inside the nucleus of a cellMade inside the nucleus of a cell Associates with proteins to form ribosomesAssociates with proteins to form ribosomes

27 Ribosomes Made of a large and small subunit Composed of rRNA (40%) and proteins (60%) Have two sites for tRNA attachment --- P and A

28 Translation Synthesis of proteins in the cytoplasmSynthesis of proteins in the cytoplasm Involves the following:Involves the following: 1.mRNA (codons) 2.tRNA (anticodons) 3.ribosomes 4.amino acids

Bell Work EOC in 13 Days!! 1.What is the function and basic organs of the integumentary system? 2.What is the function and basic organs of the excretory system? 3.Draw a picture of the flow of energy in the ecosystem. 4.What might you compare the looks of a supercoiled nucleosome to that you are familiar? P Break down a chromosome to a DNA double helix. LT 35 I can explain the process of translation.

What is the LT? Agenda 1.Bell Work / LT 2.Discussion of RNA 3.Activity / Assignment 4.Quizlet

Copyright Pearson Prentice Hall

32 Polypeptide- Many proteins Amino Acids tRNA Transcription Translation rRNA Ribosome Anti-codons Codons RNA Polymerase Primase mRNA Nucleus Cytoplasm

Copyright Pearson Prentice Hall The Genetic Code There are 64 possible base codons…

Research How does a gene Work? Copyright Pearson Prentice Hall

12–3 RNA and Protein Synthesis How does a gene Work? 1. Genes are coded DNA instructions that control the production of proteins. 2. Genetic messages can be decoded by copying part of the nucleotide sequence from DNA into RNA. 3. RNA contains coded information for making proteins.

Research What is the structure of RNA compared to DNA? Copyright Pearson Prentice Hall

The Structure of RNA There are three main differences between RNA and DNA: The sugar in RNA is ribose instead of deoxyribose. RNA is generally single-stranded. RNA contains uracil in place of thymine.

Research What are the 3 types of RNA? Copyright Pearson Prentice Hall

Types of RNA There are three main types of RNA: messenger RNA ribosomal RNA transfer RNA

Copyright Pearson Prentice Hall Types of RNA Messenger RNA (mRNA) carries copies of instructions for assembling amino acids into proteins. ***Serve as “messengers” from DNA to the rest of the cell

Copyright Pearson Prentice Hall Types of RNA Ribosomes are made up of proteins and ribosomal RNA (rRNA).

Copyright Pearson Prentice Hall Types of RNA During protein construction, transfer RNA (tRNA) transfers each amino acid to the ribosome.

Research Describe Transcription. Copyright Pearson Prentice Hall

Transcription DNA is copied in the form of a complementary sequence called RNA Requires RNA polymerase to bind to DNA and separate the DNA strands as a template to assemble the nucleotides into another DNA strand This first process is called transcription. The process begins at a section of DNA called a promoter, which has specific base sequence that signal where to start

Protein Synthesis DNAmolecule DNA strand (template) 3 TRANSCRIPTION Codon mRNA TRANSLATION Protein Amino acid 3 5 5

Copyright Pearson Prentice Hall Transcription RNA RNA polymerase DNA

Research What are the functions of introns and exons? Copyright Pearson Prentice Hall

RNA Editing Some DNA within a gene is not needed to produce or code for a protein. These areas are called introns. The DNA sequences that code for proteins are called exons.

Copyright Pearson Prentice Hall RNA Editing The introns are cut out of RNA molecules…scientist have no idea why… The exons are the spliced together to form mRNA. Exon Intron DNA Pre-mRNA mRNA Cap Tail

Bell Work Compare the DNA code to something you need a code to in your daily life. 2.What are the 3 types of RNA? 3.Explain transcription. Learning Target I can explain the genetic code.

Learning Target I can explain the genetic code. Agenda 1.Bell Work / LT 2.Plickers 3.Discussion 4.Activity

Research What is the genetic code?

Copyright Pearson Prentice Hall The Genetic Code The genetic code is the “language” of mRNA instructions. The code is written using four “letters” (the bases: A, U, C, and G).

Research What is a codon?

Copyright Pearson Prentice Hall The Genetic Code A codon consists of three consecutive nucleotides on mRNA that specify a particular amino acid.

Copyright Pearson Prentice Hall The Genetic Code There are 64 possible base codons…

Research What is translation and where does it take place?

Nucleus mRNA Copyright Pearson Prentice Hall Translation Translation is the decoding of an mRNA message into a polypeptide chain (protein). Translation takes place on ribosomes. During translation, the cell uses information from messenger RNA to produce proteins and tell what order they should be listed in on the polypeptide.

Copyright Pearson Prentice Hall Translation Lysine tRNA Phenylalanine Methionine Ribosome mRNA Start codon The ribosome binds new tRNA molecules and amino acids as it moves along the mRNA.

Copyright Pearson Prentice Hall Translation Protein Synthesis tRNA Ribosome mRNA Lysine Translation direction

Copyright Pearson Prentice Hall Translation The process continues until the ribosome reaches a stop codon. Polypeptide Ribosome tRNA mRNA

Copyright Pearson Prentice Hall Genes and Proteins DNA mRNA Protein Codon mRNA Alanine Arginine Leucine Amino acids within a polypeptide Single strand of DNA

Bell Work Are enzymes tossed away or reused? 2.Log onto Quizlet and Study for Friday’s Vocabulary Formative. Learning Target I can explain DNA structure and Replication.

Learning Target I can explain DNA structure and Replication. Agenda 1.Bell Work / LT 2.Quizlet 3.Activity 4.Plickers