Topic 3.5 Transcription and Translation What is the function of DNA? DNA controls the cell, but how? DNA controls the cell by determining which proteins.

Slides:

Advertisements

Similar presentations

Transcription and Translation

Advertisements

Do Now:.  TRANSCRIPTION: process that makes an RNA copy of DNA.  RNA is single-stranded, and T is replaced by U (A-U; G-C)  RNA polymerase makes RNA,

Cell Division, Genetics, Molecular Biology

Review: The flow of genetic information in the cell is DNA  RNA  protein  The sequence of codons in DNA spells out the primary structure of a polypeptide.

DNA as the genetic code.

10-2: RNA and 10-3: Protein Synthesis

TRANSLATION/PROTEIN SYNTHESIS Unit 4 – Part 1. Central Dogma DNA mRNA Proteins Traits.

Protein Synthesis. The DNA Code The order of bases along the DNA strand codes for the order in which amino acids are chemically joined together to form.

Gene Action Protein Synthesis.

Protein Synthesis The production (synthesis) of polypeptide chains (proteins) Two phases: Transcription & Translation mRNA must be processed before it.

Chapter 11 DNA and Genes. Proteins Form structures and control chemical reactions in cells. Polymers of amino acids. Coded for by specific sequences of.

Trait Chapter 12 Section 3. Ribonucleic acid Responsible for the movement of genetic information from the DNA in the nucleus to the site of protein.

Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis

Transcription Transcription is the synthesis of mRNA from a section of DNA. Transcription of a gene starts from a region of DNA known as the promoter.

Protein Synthesis. DNA acts like an "instruction manual“ – it provides all the information needed to function the actual work of translating the information.

Protein Synthesis. Review! What are some functions of proteins? What are some functions of proteins? Enzymes, which speed up chemical reactions Enzymes,

Do Now: Do Now: 1. What structure makes proteins? 2. Where are these found? 3. Where is DNA stored? 4. Why not in cytoplasm? Homework: read 12-3 and complete.

Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.

RNA & Protein Synthesis

Transcription and Translation. What is Transcription? It is a process that produces a complementary strand of RNA by copying a complementary strand of.

RNA and PROTEIN SYNTHESIS Chapter 13-1 & 13-2

The Genetic Code.

Protein Synthesis 1 Background Information All information is stored in DNA All information is stored in DNA RNA “reads” the DNA code RNA “reads” the.

Central Dogma DNA  RNA  Protein. …..Which leads to  Traits.

RNA and Protein Synthesis

Protein Synthesis The majority of genes are expressed as the proteins they encode. The process occurs in 2 steps: 1. Transcription (DNA---> RNA) 2. Translation.

Protein Synthesis Process that makes proteins

Transcription & Translation Transcription DNA is used to make a single strand of RNA that is complementary to the DNA base pairs. The enzyme used is.

12-3 RNA and Protein Synthesis

Structure of RNA  Structure  Nucleic acid made up of nucleotides  composed of Ribose, phosphate group, and nitrogenous base  Nitrogenous bases  Adenine.

RNA AND PROTEIN SYNTHESIS

Transcription & TranslationNovember , 2012 W ARM U P … What are the differences between DNA & RNA?

RNA Another Nucleic Acid.

Gene Expression. Central Dogma Information flows from: DNA  RNA  Protein Exception: reverse transcriptase (retroviruses) RNA  DNA  RNA  Protein.

Transcription and Translation How genes are expressed (a.k.a. How proteins are made) Biology.

Structure of DNA DNA is made up of a long chain of nucleotides

RNA & Protein Synthesis Ribose RNA. DNARNA StructureDouble Stranded Single Stranded Bases- PurinesAdenine (A) Guanine (G) Bases - Pyrimidines Cytosine.

Copyright © by Holt, Rinehart and Winston. All rights reserved. ResourcesChapter menu Flow of Genetic Information The flow of genetic information can be.

Protein Synthesis. The DNA Code The order of bases along the DNA strand codes for the order in which amino acids are chemically joined together to form.

Protein Synthesis. DNA mRNA DNA Cannot the nucleus Sends to the cytoplasm via Its base sequence (called a codon) determines the amino acid in proteins.

RNA, Transcription, and the Genetic Code. RNA = ribonucleic acid -Nucleic acid similar to DNA but with several differences DNARNA Number of strands21.

RNA & Protein Synthesis Continued: Translation. Translation: mRNA Protein Translation is taking mRNA and making proteins Sequence of nucleotide bases.

Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.

12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.

DNA Transcription and Translation Review. There are 3 types of RNA: Messenger RNA (mRNA) Ribosomal RNA (rRNA) Transfer RNA (tRNA)

DNA to RNA to Protein. RNA Made up of 1. Phosphate 2. Ribose (a sugar) 3. Four bases RNA bases are: Adenine Guanine Cytosine Uracil (instead of thymine)

Chapter 25 Protein synthesis.

PROTEIN SYNTHESIS CHAPTER 10 section 4

Protein Synthesis.

Protein Synthesis.

Protein Synthesis.

BIOLOGY NOTES GENETICS PART 7 PAGES

RNA Another Nucleic Acid.

Protein Synthesis.

Transcription and Translation

BIOLOGY NOTES GENETICS PART 7 PAGES

Transcription and Translation

Transcription & Translation.

From Genes to Proteins.

BIOLOGY NOTES GENETICS PART 7 PAGES

RNA and Protein Synthesis

Nucleic Acids: RNA Ribonucleic Acid: RNA

Transcription Steps to Transcribe DNA:

GENE EXPRESSION / PROTEIN SYNTHESIS

BIOLOGY NOTES GENETICS PART 7 PAGES

Protein Synthesis.

Protein Synthesis.

12-3 RNA & Protein Synthesis

Protein Synthesis.

Presentation transcript:

Topic 3.5 Transcription and Translation What is the function of DNA? DNA controls the cell, but how? DNA controls the cell by determining which proteins are made.

All enzymes are proteins, so DNA controls which enzymes are made. What do enzymes do? Speed up chemical reactions so they can occur at body temperature.

Every chemical reaction in a living organism is controlled by a specific enzyme

In order to make protein enzymes, DNA needs to work with RNA.

The section of DNA that codes for a polypeptide is called a _______ gene.

There are three types of RNA: mRNA (messenger RNA) tRNA (transfer RNA) rRNA (ribosomal RNA)

DNA is confined to the nucleus. mRNA carries the message from the nucleus to the cytoplasm where the protein will be made

Transcription: step 1 RNA polymerase binds to the promoter (beginning of the gene) and starts to unwind the DNA molecule.

Transcription: step 2 RNA polymerase matches free RNA nucleotides to the DNA template strand. Adenines match to uracil, Guanine to cytocine

Transcription: step 3 RNA polymerase continues matching RNA nucleotides until it reaches the termination site.

The initiation site is preceded by a sequence of A’s and T’s. The initiation site is always TAC so the first three bases of an mRNA are always _____ AUG The termination site is always one of three sets of three nucleotides.

Once mRNA is transcribed, it moves out of the nucleus to the ribosome where a protein is made.

The sequence of the DNA nucleotides determines the sequence of RNA nucleotides in the mRNA The sequence of RNA nucleotides in mRNA determines the sequence of amino acids in the protein. Next stop: Translation

Translation: step 1 The mRNA molecule attaches to the ribosome at the first two codons. A ribosome is made of rRNA and proteins A codon is a set of three nucleotides that code for one amino acid.

Translation: step 2 A tRNA matches its anticodon to the mRNA codon. Each tRNA has an specific amino acid attached to its opposite end.

A second tRNA anti codon bonds to the next codon The two amino acids are now close enough to bond. An enzyme catalyzes this condensation reaction.

The bond between the first tRNA and its amino acid is broken, the tRNA floats away to find another of the same kind of amino acid.

Another tRNA (with another amino acid) hydrogen bonds to the next mRNA codon. The ribosome moves down one codon on the mRNA.

The next two amino acids bond in a _______________ reaction condensation

This continues until the ribosome hits a stop codon. ( UAA,UAG, UGA) The tRNAs that bond to the stop codons do not have an amino acid attached so the protein is released.

One gene/one polypeptide “theory” Because each gene codes for a single mRNA and each mRNA codes for a single protein, scientists determined that each gene coded for one protein. 20,000 to 25,000 genes How many genes do humans have?

Text Scientist have recently discovered that each mRNA can be modified before it reaches the ribosome and the modifications determine which protein will be made.

Summarize Animation

atch?v=lpb5s2F1pyM

Homework: Make a chart comparing DNA and RNA (mRNA, tRNA and rRNA), including the structure (type of sugars, phospates and bases), size, shape, types of nucleotides, location and functions.