THE THREE TYPES OF RNA. Section 11.2 Summary – pages 288 - 295 There are three main types of RNA that help build proteins. # 1 Messenger RNA (mRNA) brings.

Slides:

Advertisements

Similar presentations

RNA and Protein Synthesis

Advertisements

Review: The flow of genetic information in the cell is DNA  RNA  protein  The sequence of codons in DNA spells out the primary structure of a polypeptide.

From DNA to Protein Section 11.2 Pg

Cell Protein Production

RNA and Protein Synthesis

 Assemble the DNA  Follow base pair rules  Blue—Guanine  Red—Cytosine  Purple—Thymine  Green--Adenine.

What organic molecule is DNA? Nucleic Acid. An organic molecule containing hydrogen, oxygen, nitrogen, carbon, and phosphorus Examples: DNA ???? RNA.

Translation (Protein Synthesis) RNA  protein. Making a protein Many RNAs needed –mRNA, tRNA, rRNA.

PROTEIN SYNTHESIS.

Gene to Protein Part 2: Translation After the mRNA transcript leaves the nucleus it goes to a ribosome (site of protein synthesis).

Chapter 11 DNA and Genes. Proteins Form structures and control chemical reactions in cells. Polymers of amino acids. Coded for by specific sequences of.

13.1/13.2 Protein Synthesis From DNA to Protein Protein Synthesis is the process that cells use to produce - it involves.

Protein Translation From Gene to Protein Honors Biology Ms. Kim.

Transcription Transcription is the synthesis of mRNA from a section of DNA. Transcription of a gene starts from a region of DNA known as the promoter.

NOTES: Chapter 13 - RNA & Protein Synthesis

Protein Synthesis. DNA acts like an "instruction manual“ – it provides all the information needed to function the actual work of translating the information.

Protein Synthesis Using RNA to make proteins. Going from DNA to Proteins Let’s review what we’ve done so far: We take our DNA and convert it into RNA.

Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.

VII RNA and Protein Synthesis

RNA and protein synthesis. RNA Single strand of nucleotides Sugar is ribose Uracil instead of thymine.

THE MOST IMPORTANT BIOLOGY LESSON OF THE YEAR How does DNA work?

The Genetic Code.

CFE Higher Biology DNA and the Genome Translation.

BELLRINGER: Draw the following box and fill in the squares, THIRD box on the last bell-ringer page: REPLICATIONTRANSCRIPTION Where in the cell.

Protein Synthesis Process that makes proteins

Transcription & Translation Transcription DNA is used to make a single strand of RNA that is complementary to the DNA base pairs. The enzyme used is.

12-3 RNA and Protein Synthesis

PROTEIN SYNTHESIS The formation of new proteins using the code carried on DNA.

RNA AND PROTEIN SYNTHESIS

Chapter 8 Section 8.5: Translation 1. Objectives SWBAT describe how mRNA codons are translated into amino acids. SWBAT summarize the process of protein.

 The central concept in biology is:  DNA determines what protein is made  RNA takes instructions from DNA  RNA programs the production of protein.

Amino acids are coded by mRNA base sequences.

Chapter 17 From Gene to Protein. 2 DNA contains the genes that make us who we are. The characteristics we have are the result of the proteins our cells.

DNA Transcription & Protein Translation. Today’s Objectives Introduce Protein Synthesis Compare types of nucleic acid.

Replication (not part of transcription/translation) Before a cell can divide, the DNA in the nucleus of the cell must be duplicated. Since the DNA molecule.

PROTEIN SYNTHESIS HOW GENES ARE EXPRESSED. BEADLE AND TATUM-1930’S One Gene-One Enzyme Hypothesis.

RNA & Protein Synthesis Ribose RNA. DNARNA StructureDouble Stranded Single Stranded Bases- PurinesAdenine (A) Guanine (G) Bases - Pyrimidines Cytosine.

You have been given a mission:  You must crack the code that you have been given. How many letters does it look like it requires to make just one English.

Protein Synthesis. DNA mRNA DNA Cannot the nucleus Sends to the cytoplasm via Its base sequence (called a codon) determines the amino acid in proteins.

Step 2 of protein synthesis: Translation “The players” 1.Transfer RNA (tRNA)  Folded into three-lobed shape (clover-like)  At one lobe, resides an anticodon.

Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.

12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.

Genetics 4: Translation Transfer RNA tRNA molecules are made of a single strand of RNA that folds into a 2-dimentional cloverleaf-like shape It has 3.

Transcription, RNA Processing, & Translation

Genetics: RNA and Protein Synthesis

Protein synthesis DNA is the genetic code for all life. DNA literally holds the instructions that make all life possible. Even so, DNA does not directly.

Ribosomes and Protein Synthesis

Transcription, RNA Processing, & Translation

Transcription Part of the message encoded within the sequence of bases in DNA must be transcribed into a sequence of bases in RNA before translation can.

Protein Synthesis Standards:

Protein Synthesis.

Protein Synthesis: Translation

Chp: 12 Transcription & Translation

Transcription & Translation.

12-3 RNA and Protein Synthesis

Translation (Protein Synthesis) RNA  protein.

Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.

12-3 RNA and Protein Synthesis

RNA - TRANSLATION.

Unit 7: Molecular Genetics

Ribosomes and Protein Synthesis

GENE EXPRESSION / PROTEIN SYNTHESIS

Protein Synthesis.

Higher Biology Unit 1: 1.3 Translation.

Translation: Protein Synthesis

DNA Notes Section 12.3.

Protein Synthesis.

DNA and the Genome Key Area 3c Translation.

Protein Synthesis.

Presentation transcript:

THE THREE TYPES OF RNA

Section 11.2 Summary – pages There are three main types of RNA that help build proteins. # 1 Messenger RNA (mRNA) brings instructions from DNA in the nucleus to the ribosomes. Like a contractor that takes the blueprints from the architect to the construction site

Section 11.2 Summary – pages # 2 Transfer RNA (tRNA) is the supplier. Transfer RNA delivers amino acids (the monomers of proteins) to the ribosome to be assembled into a polypeptide. Amino Acid How it binds with mRNA

Section 11.2 Summary – pages # 3 Ribosomes are made of Ribosomal RNA (rRNA). rRNA uses the instructions from mRNA and the supplies from tRNA to assemble a polypeptide.

A-site is where the tRNA binds to bring the AMINO ACIDS P-site is where the growing POLYPEPTIDE is kept. E-site is where the tRNA exits after it drops off it’s amino acid.

1. mRNA brings the instructions. 2. tRNA supplies the amino acids. 3. rRNA facilitates the tRNA and mRNA joining to form polypeptide chain. RIBOSOME

THE PROCESS OF TRANSLATING

Protein Synthesis

Section 11.2 Summary – pages Why does mRNA have to be made? (Why can’t DNA deliver it’s own instructions) Nucleus

Transcription Cap Added Tail Added Splice out introns Mature mRNA, ready to go!

Section 11.2 Summary – pages Every three letters on a mRNA strand, called a codon, is a code for a specific amino acid (a building block to make protein) The Genetic Code

Each codon codes for a specific amino acid. CODON CHART Every three letters on an mRNA strand is a codon. Things to notice: There are 64 possible codon combinations There are only 20 different amino acids Most amino acids correspond to more than one codon

Translation Changing from nucleic acid language to amino acid language. The second step of protein synthesis, in which a polypeptide chain is built at a ribosome.

WHAT DOES TRANSLATION LOOK LIKE IN THE CELL?

Section 11.2 Summary – pages The 5’ ‘capped’ end of an mRNA strand attaches to a ribosome. Step 1: mRNA strand

Section 11.2 Summary – pages Step 2: Initiation AUG is the first codon on the mRNA strand. This signals the ribosome to START making a protein. The tRNA with anti-codon UAC, holding a Methonine A.A. binds at the P-site.

Section 11.2 Summary – pages tRNAs bring amino acids to the ribosomes. tRNA’s role RIBOSOME mRNA Coming from Nucleus

Each tRNA only carries one amino acid. Amino acid

Section 11.2 Summary – pages There are also three nucleotides on the bottom of the tRNA called an anti-codon. Anti-codons complementary base pair with the codons on mRNA. (this is to make sure they are bringing the correct amino acid- If the anti-codon doesn’t base pair with the codon, then the wrong amino acid was brought) Anti-codon

After the first tRNA binds with the codon AUG, the ribosome reads the next codon at the A-site, and the complementary tRNA brings the correct amino acid. A C G U G C threonine

Step 3: Elongation Refers to the time between the beginning and end of translation in which the polypeptide is being built- amino acid by amino acid… The amino acid(s) are transferred to the new tRNA molecule in the A- site. A peptide bond is formed to add the new amino acid to the chain.

Step 3: Elongation, cont.

The mRNA slides down. The tRNA with the growing polypeptide is now in the P-site. The ‘empty’ tRNA exits the ribosome from the E- site.

Step 4: Termination A polypeptide chain is formed until a stop codon is reached. Signaling the end of Translation. A release factor binds to the stop codon and adds a water molecule instead of an amino acid.

Hydrolysis occurs, freeing the finished polypeptide.