Warm Up Draw a DNA molecule made from the 4 different nucleotides. Label each of the following one time: Hydrogen Bond Deoxyribose Phosphate Adenine Thymine Cytosine Nucleotide Guanine
Objective SWBAT describe the structure of DNA on a molecular level explain how and why DNA replication occurs and model the process
Honors Objective SWBAT Apply information from last class’s modeling activity in order to describe DNA structure explain how and why DNA replication occurs and model the process
Homework DNA Structure & Replication Review Quiz on DNA structure & replication next class
DNA Rap
DNA Structure/Function
REVIEW … 4 classes of macromolecules –Carbohydrates –Lipids –Proteins –NUCLEIC ACIDS!!! –Subunit: NUCLEOTIDES
I. DNA A. Stands for B. Structure C. Shape D. Function
I. DNA A.DNA – deoxyriboNUCLEIC ACID (de – without, oxy – oxygen, ribo – ribose sugar) B.Very long B.Very long thin molecule made up of linked nucleotides C. Double stranded helix Twisted ladder D. Determines traits of EVERY LIVING ORGANISM
II. Nucleotide Structure A. B. C.One of 4 Bases
II. Nucleotide Structure 3 parts –Sugar (deoxyribose or ribose) –Phosphate (P with oxygens attached) –Nitrogen base Adenine Thymine Guanine Cytosine
III. How Nucleotides fit together A.Sides of ladder B.Steps of the ladder
III. How Nucleotides fit together A.Sides of ladder – alternating sugars and phosphates B.Steps of the ladder – nitrogen base pairing The “steps” connect to these!
I. Nitrogen Base Pairing Complementary (You Complete Me) Adenine Thymine 4-eva Guanine Cytosine
Nitrogen Base Pairing Adenine Thymine Guanine Cytosine =
Nitrogen Base Pairing Adenine Thymine CytosineGuanine ThymineAdenine CytosineGuanine AdenineThymine Guanine Cytosine = Hydrogen Bond
Nitrogen Base Pairing Adenine Thymine CytosineGuanine ThymineAdenine CytosineGuanine AdenineThymine Guanine Cytosine
Chargaff’s Rule The # of A’s = The # of T’s The # of G’s = The # of C’s
What is the COMPLEMENTARY DNA STRAND? EXAMPLE 1 3’ end 5’ end ATTGACCATTGATAGCCGAATA TAACTGGTAACTATCGGCTTAT EXAMPLE 2 5’ end 3’ end TCTTCGGAACATTAGTCGAGGC AGAAGCCTTGTAATCAGCTCCG
Critical Thinking! If 18% of the DNA molecule is comprised of Adenine. What % do we have of Thymine, Cytosine & Guanine?
Processing 2 sentence summary2 study questions
RaceRace: finish the Complimentary Base Pairs for each Strand Rules 1.Must match up nitrogen bases to complete the complementary strand 2.One letter at a time 3.Pass the pen to partner in group who is SITTING 4.Team to get strand done in least amount of time WINS!
Histones or histone proteins Histones are a group of proteins that associate with DNA and help the DNA to condense it into chromatin.
Some Histones function as spools for the thread like DNA to wrap around. Chromatin, under the microscope in its extended form, hooks to beads on a string.
FUNCTIONS Compacting DNA strand Histones act as spools around which DNA winds. This enables the compaction necessary to fit the large genomes of eukaryotes inside cell nuclei: the compacted molecule is 40,000 times shorter than an unpacked molecule.genomes
GENOME The long, thin strands of DNA are organized into structures called chromosomes –Humans have 46 chromosomes The nucleus of a human cell contains between 25,000 and 30,000 genes. This complete set of genes is called the GENOME.
What is a Gene? A specific sequence of bases –Sequences carry the information needed for constructing proteins Proteins provide the structural components of cells and tissues as well as enzymes for essential biochemical reactions. The human genome is estimated to be made of 25,000 to 30,000 genes.
I DNA replicationDNA replication A.Definition
What is replication? The process in which DNA is duplicated
Why does DNA need to be replicated?
In order to prepare for cell division (by mitosis or meiosis) – that way, there is a copy for each new cell
Make Connections! Cell division and DNA replication Cell division GRR… Growth, Repair, Replacement When does DNA get replicated?
When replication happens At the end of Interphase, before the cell enters mitosis or meiosis
DNA replication Steps
DNA replication Step 1
DNA replication 1.DNA molecules unzips Enzyme= helicase “unzipper” Product: DNA is separated
DNA replication Step 2
DNA replication 2. Complementary Base Pairing A-T C-G Enzyme= DNA Polymerase “matchmaker” & “proofreader” Product: matches the complementary bases to the original single strands of DNA
DNA replication Step 3 –Enzyme= –Product:
DNA replication 3. Molecule is proofread for accuracy Enzyme= Ligase “glue” Product: Ligase proofreads the complementary bases and “glues” them together.
And the result is… Two identical DNA molecules have been created. Each nucleic acid molecule has one of the original strands and one new strand. This is called semi- conservative replication.
Replication
Steps DNA molecule unzipped –Helicase Complimentary Base Pairing –DNA polymerase –Matches complimentary bases to original single strands Proofreads for accuracy –Ligase –Glues two nucleotides together with hydrolysis
FYI E. Coli- (small bacteria) –4,639,221 base pairs -Human DNA -3 billion
DNA Replication Prokaryotes vs. Eukaryotes Prokaryotes Both Eukaryotes 1. DNA is in the cytoplasm 2. less DNA 3.Circular Chromosomes 4.Replication begins at a single point 1.Have DNA 2. Enzymes 1.DNA in the nucleus 2.more DNA 3.line or X shaped chromosomes 4.Replication begins at hundreds of points
Importance of Accuracy Why is it soooooo important that your DNA replicates with extreme accuracy?
Mutations Sickle Cell Anemia- a point mutation Mutations result when the DNA polymerase makes a mistake, which happens about once every 100,000,000 bases.
Questions for your notes Name the building block of DNA Draw one building block and label its 3 parts Describe the structure of DNA (what makes up the sides and steps?), including the rules for base pairing + one of your own on structure
Questions for your notes List the steps of DNA Replication Why do cells need to replicate their DNA? + one of your own on replication + 2 sentence summary (how and why)
Animation! Amoeba Sisters Explain Best! Easier to see what’s going on but doesn’t explainEasier to see what’s going on but doesn’t explain What it really looks like DNA Workshop!
PracticePractice! Show the steps of replication for this strand of DNA A T C G G C T A A T