Sophie THOMAS, PhD Hôpital Necker - Enfants Malades Institut Imagine - INSERM UMR 1163 Identification d’un nouveau gène de ciliopathies, KIAA0586, dont les mutations sont responsables d’un spectre phénotypique sévère de type Hydrolethalus et côtes courtes-polydactylie

Chevauchement phénotypique des ciliopathies viables et létales Jeune Asphyxiating Thoracic Dysplasia (JATD) Short rib-polydactyly Syndromes (SRP) Meckel syndrome (MKS) liver kidney Hydrolethalus syndrome (HLS) Joubert syndrome (JS) Acrocallosal syndrome (ACLS) Lethal Viable Severity

Exencephaly I:1 I:2 II:1II:2II:3II:4 Family 1 P d.1 Polydactyly Famille consanguine libanaise avec syndrome Hydrolethalus Alby et al. AJHG 2015 Filtering the variants dbSNP, 1kG, ExaC Exonic and splice With consequence Homozygous 1 Total variants GAPDH Exon 2 containing KIAA0586 transcripts Fetus II:3 Control RNA from cerebral tissue NGS: ciliome (S. Saunier) Mutation stop homozygote dans le gène KIAA0586

KIAA0586 : orthologue humain de Talpid3 NGS ciblé sur cas de SRP (V. Cormier-Daire and C. Huber) Ede et al Davey et al. 2014

Family 2 II:1II:2II:3 29 gw d. 60’ Family 4 II:1II:2II:3II:5II:4 I:1 I:2 d.126 gw II:1II:2 I:1I:2 <10 gw d.13 mo Family 3 I:1 I:2 II:2 A-8 A-9 A-10 A-13 A-12 A-14 A-15 A-16 II:5 A-11 II:2 A-7 A-2 A-3 A-1 A-4 A-5 A-6 KIAA0586 c.1815G>A, p.(=); Homozygote ; exon 14 Identification d’un variant synonyme de KIAA0586 dans 3 familles SRP Alby et al. AJHG 2015 Exon 13 Exon 14 Exon 15 * CTACCAACAGAGAGATGTCAGAGA Exon 13Exon 14 Exon 13 Exon 15 Control cDNA F2-II:2 cDNA ACTB F2-II:2 F2-II:3 Control CTACCAACAGAGGATGAACTGTCAAG 1644 aa 606 aa

Family 2 II:1II:2II:3 29 gw d. 60’ Family 4 II:1II:2II:3II:5II:4 I:1 I:2 d.126 gw II:1II:2 I:1I:2 <10 gw d.13 mo Family 3 I:1 I:2 KIAA0586 c.1815G>A, p.(=); Homozygote ; exon 14 Identification d’un variant synonyme de KIAA0586 dans 3 familles SRP Alby et al. AJHG 2015 Exon 13 Exon 14 Exon 15 * CTACCAACAGAGAGATGTCAGAGA Exon 13Exon 14 Exon 13 Exon 15 Control cDNA F2-II:2 cDNA ACTB F2-II:2 F2-II:3 Control CTACCAACAGAGGATGAACTGTCAAG 1644 aa 606 aa

Hedgehog pathway induction Control II:2 Control II:2 GLI1 PTCH1 GLI3-FL GLI3-R Control 1Control 2 II:2 ATCB 160KDa 110KDa 80KDa 40KDa Les mutations de KIAA0586 sont associées à un défaut de ciliogenèse et de signalisation SHH Alby et al. AJHG 2015 Adapted from Kobayashi et al SAPs DAPs Satellites

Conclusions  KIAA0586 : Novel ciliopathy gene  Lethal ciliopathies: from Hydrolethalus to SRP phenotypes  Viable ciliopathies : Joubert syndrome w/wo JATD Louise A Stephen, et al. eLife 2015;10 TALPID3 controls centrosome and cell polarity and the human ortholog KIAA0586 is mutated in Joubert syndrome (JBTS23) Ruxandra Bachmann-Gagescu, et al. Human Mutations 2015, Vol 36, No.9, Functional genome-wide siRNA screen identifies KIAA0586 as mutated in Joubert syndrome Susanne Roosing et al. eLife 2015; 4

Conclusions  KIAA0586 mutations cause ciliogenesis defects leading to abnormal SHH signaling  KIAA0586 : Novel ciliopathy gene  Lethal ciliopathies: from Hydrolethalus to SRP phenotypes  Viable ciliopathies : Joubert syndrome w/wo JATD

Conclusions  KIAA0586 mutations cause ciliogenesis defects leading to abnormal SHH signaling  KIAA0586 mutations cause abnormal satellites removal required for ciliogenesis Adapted from Kobayashi et al SAPs DAPs Satellites  KIAA0586 : Novel ciliopathy gene  Lethal ciliopathies: From Hydrolethalus to SRP phenotypes  Viable ciliopathies : Joubert syndrome w/wo JATD

Bettina Bessières Nicole Laurent Ferechté Razavi INSERM UMR1163 Caroline Alby Kevin Piquand Céline Huber Nadia El Khartoufi Amale Ichkou Michel Vekemans Arnold Munnich Stanislas Lyonnet Sophie Saunier Valérie Cormier-Daire Tania Attié-Bitach Cell Imaging & Genomics & Bioinformatics Meriem Garfa Traouré Christine Bole-Feysot Patrick Nistchke Société Française de Fœtopathologie

Ruxandra Bachmann-Gagescu, et al.

Chevauchement phénotypique des ciliopathies viables et létales Jeune Asphyxiating Thoracic Dysplasia (JATD) Short rib-polydactyly Syndromes (SRP) Meckel syndrome (MKS) liver kidney Hydrolethalus syndrome (HLS) Joubert syndrome (JS) Acrocallosal syndrome (ACLS) Lethal Viable Severity

Functional genome-wide siRNA screen identifies KIAA0586 as mutated in Joubert syndrome Susanne Roosing et al. eLife 2015; 4

ciliopathies Animal models Ciliary candidates Customized “ciliome” capture library Ciliary function/structure (From genomic & proteomic comparative studies) 1644 candidat genes Ciliary protein interactants

Hedgehog pathway induction Control II:2 Control II:2 GLI1 PTCH1 GLI3-FL GLI3-R Control 1Control 2 II:2 ATCB 160KDa 110KDa 80KDa 40KDa Les mutations de KIAA0586 sont associées à un défaut de ciliogenèse et de signalisation SHH Alby et al. AJHG 2015 SAPs DAPs Adapted from Kobayashi et al. 2014

Hedgehog pathway induction Control II:2 Control II:2 GLI1 PTCH1 GLI3-FL GLI3-R Control 1Control 2 II:2 ATCB 160KDa 110KDa 80KDa 40KDa Les mutations de KIAA0586 sont associées à un défaut de ciliogenèse et de signalisation SHH Alby et al. AJHG 2015 Adapted from Kobayashi et al Satellites SAPs DAPs Adapted from Kobayashi et al. 2014