BIOBASE Training TRANSFAC ® Containing data on eukaryotic transcription factors, their experimentally-proven binding sites, and regulated genes ExPlain™ Combining promoter and pathway analysis to understand differential gene expression
Simplifies the vast biological literature space Focuses on peer- reviewed scientific literature Experimental results are extracted by highly trained scientific curators Content is updated quarterly
Provides easy access to experimental data Information extracted from the literature is organized using controlled vocabulary standards, therefore it is easily searchable Species specific, detailed curation is organized into focused reports Analysis tools provide opportunities to leverage known information for your research needs
TRANSFAC ® and ExPlain™ advantages View how transcription factors are known to regulate target genes Perform prediction of transcription factor binding sites Model how transcription factors act together to affect gene expression patterns Understand the cause, not just the effect, of differential gene expression in response to drug treatment, disease state, environmental stimulus and more
More than 2,000,000 data points
TRANSFAC ® – TF binding site prediction Derived consensus site in form of positional weight matrix (PWM) Experimentally verified DNA binding sites from literature HIF-1 Tools for binding site prediction on the basis of the PWMs
score minFN/FN10minSUM 10 % minFP FP ( ) FP ( frequency of matches in the background set ) FN ( ) FN ( % of real sites that are not recognized ) Matrix-based Binding Site Search
Match™ – Matrix-based TF binding site search A C G T score s1 Match scans the submitted sequence with each matrix from the profile. If the matrix similarity score for a subsequence is greater than the selected cut- off, the subsequence is included as a putative binding site in the Match result. ttcttgaatgtaaacgtttaacaataaatcgcttgaat
Match™ – Matrix-based TF binding site search Match scans the submitted sequence with each matrix from the profile. If the matrix similarity score for a subsequence is greater than the selected cut- off, the subsequence is included as a putative binding site in the Match result. ttcttgaatgtaaacgtttaacaataaatcgcttgaat A C G T score s2
Match™ – Matrix-based TF binding site search Match scans the submitted sequence with each matrix from the profile. If the matrix similarity score for a subsequence is greater than the selected cut- off, the subsequence is included as a putative binding site in the Match result. ttcttgaatgtaaacgtttaacaataaatcgcttgaat A C G T score s3
Matrices included within the last year, are based on the following types of experiments: 3D structure-based energy calculations 48 bacterial-one-hybrid system (B1H) 104 ChIP-on-chip 3 ChIP-Seq 6 compiled matrix imported from literature reference 1 compiled matrix imported from public database 33 direct gel shift 2 DNA-binding affinity assay 27 DNase I footprinting 9 matrix compiled from individual genomic sites 94 SELEX (CASTing, SAAB, TDA, Target detection assay) 16 universal protein binding microarrays (PBM) 231
Find combinations of binding sites that are unique to a gene set Looks for transcriptional co-regulation Composite model analysis (CMA)
Content & Application: TRANSFAC ® & ExPlain TM ExPlain™ Analysis System Integrated Network and Promoter Analysis TRANSFAC ® Database on transcription factors, their experimentally verified binding sites, positional weight matrices,...
ExPlain™: understanding differential gene expression + / - Drug treatment Disease vs. normal + / - Environmental stimulus
TRANSFAC ® Live demo Here are the details for the training server VM: Host: Credentials for Apache Basic Authentication: Username: coh Password: coh$bio The three installed BKL builds all have users training01 - training40 (same password) set up already. I will use training01, you can use any of the remaining 39 users.